C22orf28 cdna clone

C22orf28 cDNA Clone

Gene Names

RTCB; FAAP; HSPC117; C22orf28; DJ149A16.6

Synonyms

C22orf28; C22orf28 cDNA Clone; C22orf28 cdna clone

Ordering
Cat. Num. AAA1270875 For Research Use Only!

Sequence

atgagtcgcagctataatgatgagctgcagttcttggagaagatcaataaaaactgctggaggatcaagaagggcttcgtgcccaacatgcaggttgaaggtgttttctatgtgaatgatgctctggagaaattgatgtttgaggaattaaggaatgcctgtcgaggtggtggtgttggtggcttcctgccagccatgaaacagattggcaatgtggcagccctgcctggaattgttcatcgatctattgggcttcctgatgtccattcaggatatgggtttgctattgggaacatggcagcctttgatatgaatgaccctgaagcagtagtatccccaggtggtgtcgggtttgacatcaactgtggtgtccgcttgctaagaaccaatttagatgaaagtgatgtccagcctgtgaaggagcaacttgcccaagctatgtttgaccacattcctgttggggtggggtcaaaaggtgtcatcccaatgaatgccaaagacttggaggaggccttggagatgggggtggactggtccttaagagaagggtatgcctgggctgaagacaaggagcactgcgaggagtacggaaggatgctgcaagctgaccccaataaagtttctgcaagggcgaagaaaagaggccttcctcagttggggaccctgggagcaggcaaccattatgcagaaatccaggttgtggatgagattttcaatgagtatgctgctaaaaaaatgggcatcgaccataagggacaggtgtgtgtgatgatccacagtggaagcagaggcttgggccaccaagtagccacagatgcgctggtagctatggagaaggccatgaagagagacaagattatagtcaatgatcggcagttggcttgtgctcgaatcgcttccccagagggtcaagactatctgaagggaatggcagctgctgggaactatgcctgggtcaaccgctcttccatgaccttcttaacccgtcaggctttcgccaaggtcttcaacacaacccctgatgacttggacctacatgtgatctatgatgtttctcacaacattgccaaagtggagcagcatgtggtggacggaaaggaacggacactgttagtacacaggaagggatccacccgcgctttccctcctcaccatcccctcattgctgttgattaccaactcactggacagccagtgctcattggtggcaccatgggaacctgtagttatgttcttactggcactgaacagggcatgactgagacctttggaacaacctgtcatggagcgggccgtgcattgtcccgagcaaaatctcgacgtaatttagatttccaggatgtcttagacaaattggcagatatgggaattgcgatccgtgttgcctcacccaaactggttatggaagaggctcctgagtcctataagaatgtgacagatgtggtaaatacctgccatgatgctggaatcagcaagaaagccattaaactgagaccaattgctgtgatcaaaggatag

Sequence Length

1518

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

16307524

NCBI GeneID

51493

Molecular Weight

55,210 Da

NCBI Official Full Name

Homo sapiens chromosome 22 open reading frame 28, mRNA

NCBI Official Synonym Full Names

RNA 2',3'-cyclic phosphate and 5'-OH ligase

NCBI Official Symbol

RTCB

NCBI Official Synonym Symbols

FAAP; HSPC117; C22orf28; DJ149A16.6

NCBI Protein Information

tRNA-splicing ligase RtcB homolog

UniProt Protein Name

tRNA-splicing ligase RtcB homolog

UniProt Gene Name

RTCB

UniProt Entry Name

RTCB_HUMAN

Uniprot Description

RTCB: Catalytic subunit of the tRNA-splicing ligase complex that acts by directly joining spliced tRNA halves to mature-sized tRNAs by incorporating the precursor-derived splice junction phosphate into the mature tRNA as a canonical 3',5'- phosphodiester. May act as a RNA ligase with broad substrate specificity, and may function toward other RNAs. Belongs to the RtcB family.

Protein type: EC 6.5.1.3

Chromosomal Location of Human Ortholog: 22q12

Cellular Component: cytoplasm; endoplasmic reticulum membrane; nuclear envelope; nucleoplasm; nucleus

Molecular Function: protein binding; RNA ligase (ATP) activity; vinculin binding

Biological Process: tRNA splicing

Research Articles on C22orf28

1. RTCB, the catalytic subunit of the tRNA ligase complex, and its co-factor archease mediate XBP1 mRNA splicing both in vitro and in vivo.

Similar Products

Product Notes

The C22orf28 rtcb (Catalog #AAA1270875) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtcgca gctataatga tgagctgcag ttcttggaga agatcaataa aaactgctgg aggatcaaga agggcttcgt gcccaacatg caggttgaag gtgttttcta tgtgaatgat gctctggaga aattgatgtt tgaggaatta aggaatgcct gtcgaggtgg tggtgttggt ggcttcctgc cagccatgaa acagattggc aatgtggcag ccctgcctgg aattgttcat cgatctattg ggcttcctga tgtccattca ggatatgggt ttgctattgg gaacatggca gcctttgata tgaatgaccc tgaagcagta gtatccccag gtggtgtcgg gtttgacatc aactgtggtg tccgcttgct aagaaccaat ttagatgaaa gtgatgtcca gcctgtgaag gagcaacttg cccaagctat gtttgaccac attcctgttg gggtggggtc aaaaggtgtc atcccaatga atgccaaaga cttggaggag gccttggaga tgggggtgga ctggtcctta agagaagggt atgcctgggc tgaagacaag gagcactgcg aggagtacgg aaggatgctg caagctgacc ccaataaagt ttctgcaagg gcgaagaaaa gaggccttcc tcagttgggg accctgggag caggcaacca ttatgcagaa atccaggttg tggatgagat tttcaatgag tatgctgcta aaaaaatggg catcgaccat aagggacagg tgtgtgtgat gatccacagt ggaagcagag gcttgggcca ccaagtagcc acagatgcgc tggtagctat ggagaaggcc atgaagagag acaagattat agtcaatgat cggcagttgg cttgtgctcg aatcgcttcc ccagagggtc aagactatct gaagggaatg gcagctgctg ggaactatgc ctgggtcaac cgctcttcca tgaccttctt aacccgtcag gctttcgcca aggtcttcaa cacaacccct gatgacttgg acctacatgt gatctatgat gtttctcaca acattgccaa agtggagcag catgtggtgg acggaaagga acggacactg ttagtacaca ggaagggatc cacccgcgct ttccctcctc accatcccct cattgctgtt gattaccaac tcactggaca gccagtgctc attggtggca ccatgggaac ctgtagttat gttcttactg gcactgaaca gggcatgact gagacctttg gaacaacctg tcatggagcg ggccgtgcat tgtcccgagc aaaatctcga cgtaatttag atttccagga tgtcttagac aaattggcag atatgggaat tgcgatccgt gttgcctcac ccaaactggt tatggaagag gctcctgagt cctataagaa tgtgacagat gtggtaaata cctgccatga tgctggaatc agcaagaaag ccattaaact gagaccaatt gctgtgatca aaggatag. It is sometimes possible for the material contained within the vial of "C22orf28, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

C22orf28 cdna clone