Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C1QA cdna clone

C1QA cDNA Clone

Synonyms
C1QA; C1QA cDNA Clone; C1QA cdna clone
Ordering
For Research Use Only!
Sequence
atggagggtccccggggatggctggtgctctgtgtgctggccatatcgctggcctctatggtgaccgaggacttgtgccgagcaccagacgggaagaaaggggaggcaggaagacctggcagacgggggcggccaggcctcaagggggagcaaggggagccgggggcccctggcatccggacaggcatccaaggccttaaaggagaccagggggaacctgggccctctggaaaccccggcaaggtgggctacccagggcccagcggccccctcggggcccgtggcatcccgggaattaaaggcaccaagggcagcccaggaaacatcaaggaccagccgaggccagccttctccgccattcggcggaaccccccaatggggggcaacgtggtcatcttcgacacggtcatcaccaaccaggaagaaccgtaccagaaccactccggccgattcgtctgcactgtacccggctactactacttcaccttccaggtgctgtcccagtgggaaatctgcctgtccatcgtctcctcctcaaggggccaggtccgacgctccctgggcttctgtgacaccaccaacaaggggctcttccaggtggtgtcagggggcatggtgcttcagctgcagcagggtgaccaggtctgggttgaaaaagaccccaaaaagggtcacatttaccagggctctgaggccgacagcgtcttcagcggcttcctcatcttcccatctgcctga
Sequence Length
738
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
712
Molecular Weight
26,017 Da
NCBI Official Full Name
Homo sapiens complement component 1, q subcomponent, A chain, mRNA
NCBI Official Synonym Full Names
complement C1q A chain
NCBI Official Symbol
C1QA
NCBI Protein Information
complement C1q subcomponent subunit A
UniProt Protein Name
Complement C1q subcomponent subunit A
UniProt Gene Name
C1QA
UniProt Entry Name
C1QA_HUMAN

NCBI Description

This gene encodes a major constituent of the human complement subcomponent C1q. C1q associates with C1r and C1s in order to yield the first component of the serum complement system. Deficiency of C1q has been associated with lupus erythematosus and glomerulonephritis. C1q is composed of 18 polypeptide chains: six A-chains, six B-chains, and six C-chains. Each chain contains a collagen-like region located near the N terminus and a C-terminal globular region. The A-, B-, and C-chains are arranged in the order A-C-B on chromosome 1. This gene encodes the A-chain polypeptide of human complement subcomponent C1q. [provided by RefSeq, Jul 2008]

Uniprot Description

C1QA iso2: C1q associates with the proenzymes C1r and C1s to yield C1, the first component of the serum complement system. The collagen-like regions of C1q interact with the Ca(2 )-dependent C1r(2)C1s(2) proenzyme complex, and efficient activation of C1 takes place on interaction of the globular heads of C1q with the Fc regions of IgG or IgM antibody present in immune complexes.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 1p36.12

Cellular Component: complement component C1 complex; extracellular region

Molecular Function: protein binding; serine-type endopeptidase activity

Biological Process: cell-cell signaling; complement activation; complement activation, classical pathway

Disease: C1q Deficiency

Research Articles on C1QA

Similar Products

Product Notes

The C1QA c1qa (Catalog #AAA1273692) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagggtc cccggggatg gctggtgctc tgtgtgctgg ccatatcgct ggcctctatg gtgaccgagg acttgtgccg agcaccagac gggaagaaag gggaggcagg aagacctggc agacgggggc ggccaggcct caagggggag caaggggagc cgggggcccc tggcatccgg acaggcatcc aaggccttaa aggagaccag ggggaacctg ggccctctgg aaaccccggc aaggtgggct acccagggcc cagcggcccc ctcggggccc gtggcatccc gggaattaaa ggcaccaagg gcagcccagg aaacatcaag gaccagccga ggccagcctt ctccgccatt cggcggaacc ccccaatggg gggcaacgtg gtcatcttcg acacggtcat caccaaccag gaagaaccgt accagaacca ctccggccga ttcgtctgca ctgtacccgg ctactactac ttcaccttcc aggtgctgtc ccagtgggaa atctgcctgt ccatcgtctc ctcctcaagg ggccaggtcc gacgctccct gggcttctgt gacaccacca acaaggggct cttccaggtg gtgtcagggg gcatggtgct tcagctgcag cagggtgacc aggtctgggt tgaaaaagac cccaaaaagg gtcacattta ccagggctct gaggccgaca gcgtcttcag cggcttcctc atcttcccat ctgcctga. It is sometimes possible for the material contained within the vial of "C1QA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.