C16orf5 cdna clone
C16orf5 cDNA Clone
Gene Names
CDIP1; I1; CDIP; LITAFL; C16orf5
Synonyms
C16orf5; C16orf5 cDNA Clone; C16orf5 cdna clone
Sequence
atgtccagcgagcctccccctccttatcctgggggccccacagccccacttctggaagagaaaagtggagccccgcccaccccaggccgttcctccccagctgtgatgcagccccctccaggcatgccactgccccctgcggacattggccccccaccctatgagccgccgggtcacccaatgccccagcctggcttcatcccaccacacatgagtgcagatggcacctacatgcctccgggtttctaccctcctccaggcccccacccacccatgggctactaccccccagggccctacacgccagggccctaccctggccctgggggccacacagccacagtcctggtcccttcaggagctgccaccacggtgacagtgctgcagggagagatctttgagggagcgcctgtgcagacggtgtgtccccactgccagcaggccatcaccaccaagatctcctacgagattggcttgatgaatttcgtgctgggtttcttctgttgcttcatgggatgtgatctgggctgctgcctgatcccctgcctcatcaatgacttcaaggatgtgacgcacacatgccccagctgcaaagcctacatctacacgtacaagcgcctgtgctaa
Sequence Length
627
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
13,763 Da
NCBI Official Full Name
Homo sapiens chromosome 16 open reading frame 5, mRNA
NCBI Official Synonym Full Names
cell death inducing p53 target 1
NCBI Official Symbol
CDIP1
NCBI Official Synonym Symbols
I1; CDIP; LITAFL; C16orf5
NCBI Protein Information
cell death-inducing p53-target protein 1
UniProt Protein Name
Cell death-inducing p53-target protein 1
UniProt Gene Name
CDIP1
UniProt Synonym Gene Names
C16orf5; CDIP; LITAFL
UniProt Entry Name
CDIP1_HUMAN
Uniprot Description
CDIP: Belongs to the LITAF family.
Protein type: Apoptosis
Chromosomal Location of Human Ortholog: 16p13.3
Cellular Component: nucleus
Molecular Function: protein binding
Biological Process: apoptosis; DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis; tumor necrosis factor-mediated signaling pathway
Research Articles on C16orf5
Similar Products
Product Notes
The C16orf5 cdip1 (Catalog #AAA1274663) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccagcg agcctccccc tccttatcct gggggcccca cagccccact tctggaagag aaaagtggag ccccgcccac cccaggccgt tcctccccag ctgtgatgca gccccctcca ggcatgccac tgccccctgc ggacattggc cccccaccct atgagccgcc gggtcaccca atgccccagc ctggcttcat cccaccacac atgagtgcag atggcaccta catgcctccg ggtttctacc ctcctccagg cccccaccca cccatgggct actacccccc agggccctac acgccagggc cctaccctgg ccctgggggc cacacagcca cagtcctggt cccttcagga gctgccacca cggtgacagt gctgcaggga gagatctttg agggagcgcc tgtgcagacg gtgtgtcccc actgccagca ggccatcacc accaagatct cctacgagat tggcttgatg aatttcgtgc tgggtttctt ctgttgcttc atgggatgtg atctgggctg ctgcctgatc ccctgcctca tcaatgactt caaggatgtg acgcacacat gccccagctg caaagcctac atctacacgt acaagcgcct gtgctaa. It is sometimes possible for the material contained within the vial of "C16orf5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
