C14orf159 cdna clone
C14orf159 cDNA Clone
Synonyms
C14orf159; C14orf159 cDNA Clone; C14orf159 cdna clone
Sequence
atgcccttcacactccacctgaggtcccgccttccctctgccataaggagtttgattctacaaaagaaaccaaacatcagaaatacatccagcatggctggagagctccgaccagccagcctggtggtcctgcccaggtcccttgctccagcttttgaaagattctgccaggtcaacactggtcctctacccctgctgggccagagtgagccagaaaagtggatgctgccccctcaaggtgctatctcagagaccaggatgggccatccccagttctggaaatacgagttcggtgcctgcaccggtagcctggcttcgctggagcagtactcggagcagctgaaggacatggtggccttcttcctgggctgcagcttctccctggaggaggccttggagaaagcggggctccccagaagagacccagcaggtcacagccagacaacagtgccttgtgttacccatgctggcttctgctgccctctggtggtcacgatgaggcccattcccaaggacaagctggaagggctggtgcgggcctgctgctccctcggaggtgagcaggggcaacctgttcacatgggcgacccagaactgttgggaatcaaagagctttccaaacctgcctacggggatgccatggtgtgtcccccaggggaggttccagtgttctggccttctccgctgaccagtctcggagctgtcagcagctgtgagaccccactggcttttgccagcatcccaggctgcacagttatgactgacctgaaggatgcaaaggctccacctggttgtctcaccccagagagaattccagaggtccatcacatttcccaagatcctctgcactacagcatcgcgtcagtctctgcttctcagaagatcagagaactagagtctatgatcggcatagacccagggaaccgggggattgggcacctgctctgtaaagatgagctgctgaaggcctctctctcgctgtcccatgcccgctcagtgctcatcaccactgggttccccacacatttcaatcatgagcctccagaagagacagatggcccaccaggagctgttgctctggttgccttcctgcaggccttggagaaggaggtcgccataatcgttgaccagagagcctggaacttgcaccagaagattgttgaagatgctgttgagcaaggtgttctgaagacgcagatcccgatattaacttaccaaggtggatcagtggaagctgctcaggcattcctgtgcaaaaatggggacccgcagacacctagatttgaccacctggtggccatagagcgtgccggaagagctgctgatggcaattactacaatgcaaggaagatgaacatcaagcacttggttgaccccattgacgatctttttcttgctgcgaagaagattcctggaatctcatcaactggagtcggtgatggaggcaacgagcttgggatgggtaaagtcaaggaggctgtgaggaggcacatacggcacggggatgtcatcgcctgcgacgtggaggctgactttgccgtcattgctggtgtttctaactggggaggctatgccctggcctgcgcactctacatcctgtactcatgtgctgtccacagtcagtacctgaggaaagcagtcggaccctccagggcacctggagatcaggcctggactcaggccctcccgtcggtcattaaggaagaaaaaatgctgggcatcttggtgcagcacaaagtccggagtggcgtctcgggcatcgtgggcatggaggtggatgggctgcccttccacaacacccacgccgagatgatccagaagctggtggacgtcaccacggcacaggtgtaa
Sequence Length
1851
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
17,705 Da
NCBI Official Full Name
Homo sapiens chromosome 14 open reading frame 159, mRNA
NCBI Official Synonym Full Names
chromosome 14 open reading frame 159
NCBI Official Symbol
C14orf159
NCBI Protein Information
UPF0317 protein C14orf159, mitochondrial
UniProt Protein Name
UPF0317 protein C14orf159, mitochondrial
Protein Family
UniProt Gene Name
C14orf159
UniProt Entry Name
CN159_HUMAN
Uniprot Description
C14orf159: Belongs to the UPF0317 family. 6 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 14q32.11
Molecular Function: protein binding
Research Articles on C14orf159
Similar Products
Product Notes
The C14orf159 c14orf159 (Catalog #AAA1275769) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccttca cactccacct gaggtcccgc cttccctctg ccataaggag tttgattcta caaaagaaac caaacatcag aaatacatcc agcatggctg gagagctccg accagccagc ctggtggtcc tgcccaggtc ccttgctcca gcttttgaaa gattctgcca ggtcaacact ggtcctctac ccctgctggg ccagagtgag ccagaaaagt ggatgctgcc ccctcaaggt gctatctcag agaccaggat gggccatccc cagttctgga aatacgagtt cggtgcctgc accggtagcc tggcttcgct ggagcagtac tcggagcagc tgaaggacat ggtggccttc ttcctgggct gcagcttctc cctggaggag gccttggaga aagcggggct ccccagaaga gacccagcag gtcacagcca gacaacagtg ccttgtgtta cccatgctgg cttctgctgc cctctggtgg tcacgatgag gcccattccc aaggacaagc tggaagggct ggtgcgggcc tgctgctccc tcggaggtga gcaggggcaa cctgttcaca tgggcgaccc agaactgttg ggaatcaaag agctttccaa acctgcctac ggggatgcca tggtgtgtcc cccaggggag gttccagtgt tctggccttc tccgctgacc agtctcggag ctgtcagcag ctgtgagacc ccactggctt ttgccagcat cccaggctgc acagttatga ctgacctgaa ggatgcaaag gctccacctg gttgtctcac cccagagaga attccagagg tccatcacat ttcccaagat cctctgcact acagcatcgc gtcagtctct gcttctcaga agatcagaga actagagtct atgatcggca tagacccagg gaaccggggg attgggcacc tgctctgtaa agatgagctg ctgaaggcct ctctctcgct gtcccatgcc cgctcagtgc tcatcaccac tgggttcccc acacatttca atcatgagcc tccagaagag acagatggcc caccaggagc tgttgctctg gttgccttcc tgcaggcctt ggagaaggag gtcgccataa tcgttgacca gagagcctgg aacttgcacc agaagattgt tgaagatgct gttgagcaag gtgttctgaa gacgcagatc ccgatattaa cttaccaagg tggatcagtg gaagctgctc aggcattcct gtgcaaaaat ggggacccgc agacacctag atttgaccac ctggtggcca tagagcgtgc cggaagagct gctgatggca attactacaa tgcaaggaag atgaacatca agcacttggt tgaccccatt gacgatcttt ttcttgctgc gaagaagatt cctggaatct catcaactgg agtcggtgat ggaggcaacg agcttgggat gggtaaagtc aaggaggctg tgaggaggca catacggcac ggggatgtca tcgcctgcga cgtggaggct gactttgccg tcattgctgg tgtttctaac tggggaggct atgccctggc ctgcgcactc tacatcctgt actcatgtgc tgtccacagt cagtacctga ggaaagcagt cggaccctcc agggcacctg gagatcaggc ctggactcag gccctcccgt cggtcattaa ggaagaaaaa atgctgggca tcttggtgca gcacaaagtc cggagtggcg tctcgggcat cgtgggcatg gaggtggatg ggctgccctt ccacaacacc cacgccgaga tgatccagaa gctggtggac gtcaccacgg cacaggtgta a. It is sometimes possible for the material contained within the vial of "C14orf159, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
