C12orf10 cdna clone

C12orf10 cDNA Clone

Gene Names

C12orf10; MYG; MYG1; Gamm1; MST024; MSTP024

Synonyms

C12orf10; C12orf10 cDNA Clone; C12orf10 cdna clone

Ordering
Cat. Num. AAA1277320 For Research Use Only!

Sequence

atgggacaccgcttcctgcgcggcctcttaacgctgctgctgccgccgccacccctgtatacccggcaccgcatgctcggtccagagtccgtcccgcccccaaaacgatcccgcagcaaactcatggcaccgccccgaatcgggacgcacaatggcaccttccactgcgacgaggcactggcatgcgcactgcttcgcctcctgccggagtaccgggatgcagagattgtgcggacccgggatcccgaaaaactcgcttcctgtgacatcgtggtggacgtggggggcgagtacgaccctcggagacaccgatatgaccatcaccagaggtctttcacagagaccatgagctccctgtcccctgggaagccgtggcagaccaagctgagcagtgcgggactcatctatctgcacttcgggcacaagctgctggcccagttgctgggcactagtgaagaggacagcatggtgggcaccctctatgacaagatgtatgagaactttgtggaggaggtggatgctgtggacaatgggatctcccagtgggcagagggggagcctcgatatgcactgaccactaccctgagtgcacgagttgctcgacttaatcctacctggaaccaccccgaccaagacactgaggcagggttcaagcgtgcaatggatctggttcaagaggagtttctgcagagattagatttctaccaacacagctggctgccagcccgggccttggtggaagaggcccttgcccagcgattccaggtggacccaagtggagagattgtggaactggcgaaaggtgcatgtccctggaaggagcatctctaccacctggaatctgggctgtcccctccagtggccatcttctttgttatctacactgaccaggctggacagtggcgaatacagtgtgtgcccaaggagccccactcattccaaagccggctgcccctgccagagccatggcggggtcttcgggacgaggccctggaccaggtcagtgggatccctggctgcatcttcgtccatgcaagcggcttcattggcggtcaccgcacccgagagggtgccttgagcatggcccgtgccaccttggcccagcgctcatacctcccacaaatctcctag

Sequence Length

1131

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

30704876

NCBI GeneID

60314

Molecular Weight

42,449 Da

NCBI Official Full Name

Homo sapiens chromosome 12 open reading frame 10, mRNA

NCBI Official Synonym Full Names

chromosome 12 open reading frame 10

NCBI Official Symbol

C12orf10

NCBI Official Synonym Symbols

MYG; MYG1; Gamm1; MST024; MSTP024

NCBI Protein Information

UPF0160 protein MYG1, mitochondrial

UniProt Protein Name

UPF0160 protein MYG1, mitochondrial

UniProt Gene Name

C12orf10

UniProt Entry Name

MYG1_HUMAN

Uniprot Description

Myg1: Belongs to the UPF0160 (MYG1) family.

Chromosomal Location of Human Ortholog: 12q13

Cellular Component: mitochondrion; nucleoplasm; nucleus

Research Articles on C12orf10

1. Significant increase in MYG1 mRNA expression was observed in vitiligo patients compared to controls. The MYG1 mRNA expression was increased in patients with active and generalized vitiligo as compared to stable and localized vitiligo.

Similar Products

Product Notes

The C12orf10 c12orf10 (Catalog #AAA1277320) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggacacc gcttcctgcg cggcctctta acgctgctgc tgccgccgcc acccctgtat acccggcacc gcatgctcgg tccagagtcc gtcccgcccc caaaacgatc ccgcagcaaa ctcatggcac cgccccgaat cgggacgcac aatggcacct tccactgcga cgaggcactg gcatgcgcac tgcttcgcct cctgccggag taccgggatg cagagattgt gcggacccgg gatcccgaaa aactcgcttc ctgtgacatc gtggtggacg tggggggcga gtacgaccct cggagacacc gatatgacca tcaccagagg tctttcacag agaccatgag ctccctgtcc cctgggaagc cgtggcagac caagctgagc agtgcgggac tcatctatct gcacttcggg cacaagctgc tggcccagtt gctgggcact agtgaagagg acagcatggt gggcaccctc tatgacaaga tgtatgagaa ctttgtggag gaggtggatg ctgtggacaa tgggatctcc cagtgggcag agggggagcc tcgatatgca ctgaccacta ccctgagtgc acgagttgct cgacttaatc ctacctggaa ccaccccgac caagacactg aggcagggtt caagcgtgca atggatctgg ttcaagagga gtttctgcag agattagatt tctaccaaca cagctggctg ccagcccggg ccttggtgga agaggccctt gcccagcgat tccaggtgga cccaagtgga gagattgtgg aactggcgaa aggtgcatgt ccctggaagg agcatctcta ccacctggaa tctgggctgt cccctccagt ggccatcttc tttgttatct acactgacca ggctggacag tggcgaatac agtgtgtgcc caaggagccc cactcattcc aaagccggct gcccctgcca gagccatggc ggggtcttcg ggacgaggcc ctggaccagg tcagtgggat ccctggctgc atcttcgtcc atgcaagcgg cttcattggc ggtcaccgca cccgagaggg tgccttgagc atggcccgtg ccaccttggc ccagcgctca tacctcccac aaatctccta g. It is sometimes possible for the material contained within the vial of "C12orf10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

C12orf10 cdna clone