Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C10orf125 cdna clone

C10orf125 cDNA Clone

Gene Names
FUOM; FUCU; FucM; C10orf125
Synonyms
C10orf125; C10orf125 cDNA Clone; C10orf125 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGTGGCGCTGAAGGGTGTCCCCGCACTGCTGTCCCCCGAGCTGCTCTACGCGCTGGCGCGGATGGGGCACGGGGACGAGATCGTTCTTGCGGACTTGAACTTCCCGGCCTCCTCCATCTGCCAGTGTGGGCCCATGGAGATCCGTGCAGACGGCCTGGGCATCCCGCAGCTCCTGGAGGCCGTGCTGAAGCTGCTGCCCCTGGACACCTATGTGGAGAGTCCGGCTGCAGTCATGGAGCTGGTGCCCAGCGACAAGGAGAGGGGCCTGCAGACCCCAGTGTGGACGGAGTACGAGTCCATCCTACGCAGGGCCGGCTGTGTGAGAGCCCTGGCAAAGATAGAGAGGTTTGAGTTTTATGAACGGGCTAAGAAGGCTTTTGCTGTTGTGGCAACGGGATGCTGA
Sequence Length
405
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,604 Da
NCBI Official Full Name
Homo sapiens chromosome 10 open reading frame 125, mRNA
NCBI Official Synonym Full Names
fucose mutarotase
NCBI Official Symbol
FUOM
NCBI Official Synonym Symbols
FUCU; FucM; C10orf125
NCBI Protein Information
fucose mutarotase
UniProt Protein Name
Fucose mutarotase
UniProt Gene Name
FUOM
UniProt Synonym Gene Names
C10orf125
UniProt Entry Name
FUCM_HUMAN

Uniprot Description

FUOM: Involved in the interconversion between alpha- and beta- L-fucoses. L-Fucose (6-deoxy-L-galactose) exists as alpha-L-fucose (29.5%) and beta-L-fucose (70.5%), the beta-form is metabolized through the salvage pathway. GDP-L-fucose formed either by the de novo or salvage pathways is transported into the endoplasmic reticulum, where it serves as a substrate for N- and O- glycosylations by fucosyltransferases. Fucosylated structures expressed on cell surfaces or secreted in biological fluids are believed to play a critical role in cell-cell adhesion and recognition processes. Belongs to the RbsD / FucU family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 5.1.3.29

Chromosomal Location of Human Ortholog: 10q26.3

Cellular Component: cytosol

Molecular Function: fucose binding; racemase and epimerase activity, acting on carbohydrates and derivatives

Biological Process: fucose metabolic process

Research Articles on C10orf125

Similar Products

Product Notes

The C10orf125 fuom (Catalog #AAA1275719) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGTGGCGC TGAAGGGTGT CCCCGCACTG CTGTCCCCCG AGCTGCTCTA CGCGCTGGCG CGGATGGGGC ACGGGGACGA GATCGTTCTT GCGGACTTGA ACTTCCCGGC CTCCTCCATC TGCCAGTGTG GGCCCATGGA GATCCGTGCA GACGGCCTGG GCATCCCGCA GCTCCTGGAG GCCGTGCTGA AGCTGCTGCC CCTGGACACC TATGTGGAGA GTCCGGCTGC AGTCATGGAG CTGGTGCCCA GCGACAAGGA GAGGGGCCTG CAGACCCCAG TGTGGACGGA GTACGAGTCC ATCCTACGCA GGGCCGGCTG TGTGAGAGCC CTGGCAAAGA TAGAGAGGTT TGAGTTTTAT GAACGGGCTA AGAAGGCTTT TGCTGTTGTG GCAACGGGAT GCTGA. It is sometimes possible for the material contained within the vial of "C10orf125, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.