Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BRCC3 cdna clone

BRCC3 cDNA Clone

Gene Names
BRCC3; C6.1A; BRCC36; CXorf53
Synonyms
BRCC3; BRCC3 cDNA Clone; BRCC3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggtgcaggtggtgcaggcggtgcaggcggttcatctcgagtctgacgctttcctcgtttgtctcaaccacgctctgagcacagagaaggaggaagtaatggggctgtgcataggggagttgaacgatgatacaaggagtgactccaaatttgcatatactggaactgaaatgcgcacagttgctgaaaaggttgatgccgtcagaattgttcacattcattctgtcatcatcttacgacgttctgataagaggaaggaccgagtagaaatttctccagagcagctgtctgcagcttcaacagaggcagagaggttggctgaactgacaggccgccccatgagagttgtgggctggtatcattcccatcctcatataactgtttggccttcacatgttgatgttcgcacacaagccatgtaccagatgatggatcaaggctttgtaggacttattttttcctgtttcatagaagataagaacacaaagactggccgggtactctacacttgcttccaatccatacaggcccaaaagagttcagagtcccttcatggtccacgagacttctggagctccagccagcacatctccattgagggccagaaggaagaggaaaggtatgagagaatcgaaatcccaatccatattgtacctcatgtcactatcgggaaagtgtgccttgaatcagcagtagagctgcccaagatcctgtgccaggaggagcaggatgcgtataggaggatccacagccttacacatctggactcagtaaccaagatccataatggctcagtgtttaccaagaatctgtgcagtcagatgtcggcagtcagcgggcctctcctacagtggttggaggacagactggagcaaaaccaacagcatttgcaggaattacaacaagaaaaggaagagcttatgcaagaactttcttctctagaataa
Sequence Length
951
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,027 Da
NCBI Official Full Name
Homo sapiens BRCA1/BRCA2-containing complex, subunit 3, mRNA
NCBI Official Synonym Full Names
BRCA1/BRCA2-containing complex subunit 3
NCBI Official Symbol
BRCC3
NCBI Official Synonym Symbols
C6.1A; BRCC36; CXorf53
NCBI Protein Information
lys-63-specific deubiquitinase BRCC36
UniProt Protein Name
Lys-63-specific deubiquitinase BRCC36
UniProt Gene Name
BRCC3
UniProt Synonym Gene Names
BRCC36; C6.1A; CXorf53
UniProt Entry Name
BRCC3_HUMAN

NCBI Description

This gene encodes a subunit of the BRCA1-BRCA2-containing complex (BRCC), which is an E3 ubiquitin ligase. This complex plays a role in the DNA damage response, where it is responsible for the stable accumulation of BRCA1 at DNA break sites. The component encoded by this gene can specifically cleave Lys 63-linked polyubiquitin chains, and it regulates the abundance of these polyubiquitin chains in chromatin. The loss of this gene results in abnormal angiogenesis and is associated with syndromic moyamoya, a cerebrovascular angiopathy. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Jun 2011]

Uniprot Description

BRCC3: Metalloprotease that specifically cleaves 'Lys-63'- linked polyubiquitin chains. Does not have activity toward 'Lys- 48'-linked polyubiquitin chains. Component of the BRCA1-A complex, a complex that specifically recognizes 'Lys-63'-linked ubiquitinated histones H2A and H2AX at DNA lesions sites, leading to target the BRCA1-BARD1 heterodimer to sites of DNA damage at double-strand breaks (DSBs). In the BRCA1-A complex, it specifically removes 'Lys-63'-linked ubiquitin on histones H2A and H2AX, antagonizing the RNF8-dependent ubiquitination at double- strand breaks (DSBs). Catalytic subunit of the BRISC complex, a multiprotein complex that specifically cleaves 'Lys-63'-linked ubiquitin in various substrates. Mediates the specific 'Lys-63'- specific deubiquitination associated with the COP9 signalosome complex (CSN), via the interaction of the BRISC complex with the CSN complex. A chromosomal aberration involving BRCC3 is a cause of pro-lymphocytic T-cell leukemia (T-PLL). Translocation t(X;14)(q28;q11) with TCRA. Belongs to the peptidase M67A family. BRCC36 subfamily. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; Oncoprotein; Ubiquitin-specific protease; EC 3.4.19.-

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: cytoplasm; nuclear ubiquitin ligase complex; nucleoplasm; nucleus; ubiquitin ligase complex

Molecular Function: enzyme regulator activity; metallopeptidase activity; polyubiquitin binding; protein binding; ubiquitin-specific protease activity

Biological Process: double-strand break repair; double-strand break repair via nonhomologous end joining; G2/M transition DNA damage checkpoint; positive regulation of DNA repair; response to ionizing radiation; response to X-ray

Research Articles on BRCC3

Similar Products

Product Notes

The BRCC3 brcc3 (Catalog #AAA1268422) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggtgc aggtggtgca ggcggtgcag gcggttcatc tcgagtctga cgctttcctc gtttgtctca accacgctct gagcacagag aaggaggaag taatggggct gtgcataggg gagttgaacg atgatacaag gagtgactcc aaatttgcat atactggaac tgaaatgcgc acagttgctg aaaaggttga tgccgtcaga attgttcaca ttcattctgt catcatctta cgacgttctg ataagaggaa ggaccgagta gaaatttctc cagagcagct gtctgcagct tcaacagagg cagagaggtt ggctgaactg acaggccgcc ccatgagagt tgtgggctgg tatcattccc atcctcatat aactgtttgg ccttcacatg ttgatgttcg cacacaagcc atgtaccaga tgatggatca aggctttgta ggacttattt tttcctgttt catagaagat aagaacacaa agactggccg ggtactctac acttgcttcc aatccataca ggcccaaaag agttcagagt cccttcatgg tccacgagac ttctggagct ccagccagca catctccatt gagggccaga aggaagagga aaggtatgag agaatcgaaa tcccaatcca tattgtacct catgtcacta tcgggaaagt gtgccttgaa tcagcagtag agctgcccaa gatcctgtgc caggaggagc aggatgcgta taggaggatc cacagcctta cacatctgga ctcagtaacc aagatccata atggctcagt gtttaccaag aatctgtgca gtcagatgtc ggcagtcagc gggcctctcc tacagtggtt ggaggacaga ctggagcaaa accaacagca tttgcaggaa ttacaacaag aaaaggaaga gcttatgcaa gaactttctt ctctagaata a. It is sometimes possible for the material contained within the vial of "BRCC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.