BCAS1 cdna clone
BCAS1 cDNA Clone
Gene Names
BCAS1; AIBC1; NABC1
Synonyms
BCAS1; BCAS1 cDNA Clone; BCAS1 cdna clone
Sequence
atgggtaaccaaatgagtgttccccaaagagttgaagaccaagagaatgaaccagaagcagagacttacaaggacaacgcgtctgctctgaacggggttccagtggtggtgtcgacccacacagttcagcacttagaggaagtcgacttgggaataagtgtcaagacggataatgtggccacttcttcccccgagacaacggagataagtgctgttgcggatgccaacggaaagaatcttgggaaagaggccaaacccgaggcaccagctgctaaatctcgttttttcttgatgctctctcggcctgtaccaggacgtaccggagaccaagccgcagattcatcccttggatcagtgaagcttgatgtcagctccaataaagctccagcgaacaaagacccaagtgagagctggacacttccggtggcagctggaccggggcaggacacagataaaaccccagggcacgccccggcccaagacaaggccctctctgccgccagggatcccacgcttctcccacctgagacagggggagcaggaggagaagctccctccaagcccaaggactccagcttttttgacaaattcttcaagctggacaagggacaggaaaaggtgccaggtgacagccaacaggaagccaagagggcagagcatcaagacaaggtggatgaggttcctggcttatcagggcagtccgatgatgtccctgcagggaaggacatagttgacggcaaggaaaaggaaggacaagaacttggaactgcggattgctctgtccctggggacccagaaggactggagactgcaaaggacgattcccaggcagcagctatagcagagaataataattccatcatgagtttctttaaaactctggtttcacctaacaaagctgaaacaaaaaaggacccagaagacacgggtgctgaaaagtcacccaccacttcagctgaccttaagtcagacaaagccaactttacatcccaggagacccaaggggctggcaagaattccaaaggatgcaacccatcggggcacacacagtccgtgacaacccctgaacctgcgaaggaaggcaccaaggagaaatcaggacccacctctctgcctctgggcaaactgttttggaaaaagtcagttaaagaggactcagtccccacaggtgcggaggagaatgtggtgtgtgagtcaccagtagagattataaagtccaaggaagtagaatcagccttacaaacagtggacctcaacgaaggagatgctgcacctgaacccacagaagcgaaactcaaaagagaagaaagcaaaccaagaacctctctgatggcgtttctcagacaaatgtcagtgaaaggggatggagggatcacccactcagaagaaataaatgggaaagactccagctgccaaacatcagactccacagaaaagactatcacaccgccagagcctgaaccaacaggagcaccacagaagggtaaagagggctcctcgaaggacaagaagtcagcagccgagatgaacaagcagaagagcaacaagcaggaagccaaagaaccagcccagtgcacagagcaggccacggtggacacgaactcactgcagaatggggacaagctccaaaagagacctgagaagcggcagcagtcccttgggggcttctttaaaggcctgggaccaaagcggatgttggatgctcaagtgcaaacagacccagtatccatcggaccagttggcaaatccaagtaa
Sequence Length
1755
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
65,663 Da
NCBI Official Full Name
Homo sapiens breast carcinoma amplified sequence 1, mRNA
NCBI Official Synonym Full Names
breast carcinoma amplified sequence 1
NCBI Official Symbol
BCAS1
NCBI Official Synonym Symbols
AIBC1; NABC1
NCBI Protein Information
breast carcinoma-amplified sequence 1
UniProt Protein Name
Breast carcinoma-amplified sequence 1
Protein Family
UniProt Gene Name
BCAS1
UniProt Synonym Gene Names
AIBC1; NABC1
UniProt Entry Name
BCAS1_HUMAN
NCBI Description
This gene resides in a region at 20q13 which is amplified in a variety of tumor types and associated with more aggressive tumor phenotypes. Among the genes identified from this region, it was found to be highly expressed in three amplified breast cancer cell lines and in one breast tumor without amplification at 20q13.2. However, this gene is not in the common region of maximal amplification and its expression was not detected in the breast cancer cell line MCF7, in which this region is highly amplified. Although not consistently expressed, this gene is a candidate oncogene. [provided by RefSeq, Apr 2016]
Uniprot Description
BCAS1: 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 20q13.2
Research Articles on BCAS1
Similar Products
Product Notes
The BCAS1 bcas1 (Catalog #AAA1277785) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtaacc aaatgagtgt tccccaaaga gttgaagacc aagagaatga accagaagca gagacttaca aggacaacgc gtctgctctg aacggggttc cagtggtggt gtcgacccac acagttcagc acttagagga agtcgacttg ggaataagtg tcaagacgga taatgtggcc acttcttccc ccgagacaac ggagataagt gctgttgcgg atgccaacgg aaagaatctt gggaaagagg ccaaacccga ggcaccagct gctaaatctc gttttttctt gatgctctct cggcctgtac caggacgtac cggagaccaa gccgcagatt catcccttgg atcagtgaag cttgatgtca gctccaataa agctccagcg aacaaagacc caagtgagag ctggacactt ccggtggcag ctggaccggg gcaggacaca gataaaaccc cagggcacgc cccggcccaa gacaaggccc tctctgccgc cagggatccc acgcttctcc cacctgagac agggggagca ggaggagaag ctccctccaa gcccaaggac tccagctttt ttgacaaatt cttcaagctg gacaagggac aggaaaaggt gccaggtgac agccaacagg aagccaagag ggcagagcat caagacaagg tggatgaggt tcctggctta tcagggcagt ccgatgatgt ccctgcaggg aaggacatag ttgacggcaa ggaaaaggaa ggacaagaac ttggaactgc ggattgctct gtccctgggg acccagaagg actggagact gcaaaggacg attcccaggc agcagctata gcagagaata ataattccat catgagtttc tttaaaactc tggtttcacc taacaaagct gaaacaaaaa aggacccaga agacacgggt gctgaaaagt cacccaccac ttcagctgac cttaagtcag acaaagccaa ctttacatcc caggagaccc aaggggctgg caagaattcc aaaggatgca acccatcggg gcacacacag tccgtgacaa cccctgaacc tgcgaaggaa ggcaccaagg agaaatcagg acccacctct ctgcctctgg gcaaactgtt ttggaaaaag tcagttaaag aggactcagt ccccacaggt gcggaggaga atgtggtgtg tgagtcacca gtagagatta taaagtccaa ggaagtagaa tcagccttac aaacagtgga cctcaacgaa ggagatgctg cacctgaacc cacagaagcg aaactcaaaa gagaagaaag caaaccaaga acctctctga tggcgtttct cagacaaatg tcagtgaaag gggatggagg gatcacccac tcagaagaaa taaatgggaa agactccagc tgccaaacat cagactccac agaaaagact atcacaccgc cagagcctga accaacagga gcaccacaga agggtaaaga gggctcctcg aaggacaaga agtcagcagc cgagatgaac aagcagaaga gcaacaagca ggaagccaaa gaaccagccc agtgcacaga gcaggccacg gtggacacga actcactgca gaatggggac aagctccaaa agagacctga gaagcggcag cagtcccttg ggggcttctt taaaggcctg ggaccaaagc ggatgttgga tgctcaagtg caaacagacc cagtatccat cggaccagtt ggcaaatcca agtaa. It is sometimes possible for the material contained within the vial of "BCAS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
