Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BAG2 cdna clone

BAG2 cDNA Clone

Gene Names
BAG2; BAG-2; dJ417I1.2
Synonyms
BAG2; BAG2 cDNA Clone; BAG2 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGCTCAGGCGAAGATCAACGCTAAAGCCAACGAGGGGCGCTTCTGCCGCTCCTCCTCCATGGCTGACCGCTCCAGCCGCCTGCTGGAGAGCCTGGACCAGCTGGAGCTCAGGGTTGAAGCTTTGAGAGAAGCAGCAACTGCTGTTGAGCAAGAGAAAGAAATCCTTCTGGAAATGATCCACAGTATCCAAAATAGCCAGGACATGAGGCAGATCAGTGACGGAGAAAGAGAAGAATTAAATCTGACTGCAAACCGTTTGATGGGAAGAACTCTCACCGTTGAAGTGTCAGTAGAAACAATTAGAAACCCCCAGCAGCAAGAATCCCTAAAGCATGCCACAAGGATTATTGATGAGGTGGTCAATAAGTTTCTGGATGATTTGGGAAATGCCAAGAGTCATTTAATGTCGCTCTACAGTGCATGTTCATCTGAGGTGCCACATGGGCCAGTTGATCAGAAGTTTCAATCCATAGTAATTGGCTGTGCTCTTGAAGATCAGAAGAAAATTAAGAGAAGATTAGAGACTCTGCTTAGAAATATTGAAAACTCTGACAAGGCCATCAAGCTATTAGAGCATTCTAAAGGAGCTGGTTCCAAAACTCTGCAACAAAATGCTGAAAGCAGATTCAATTAG
Sequence Length
636
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,189 Da
NCBI Official Full Name
Homo sapiens BCL2-associated athanogene 2, mRNA
NCBI Official Synonym Full Names
BCL2 associated athanogene 2
NCBI Official Symbol
BAG2
NCBI Official Synonym Symbols
BAG-2; dJ417I1.2
NCBI Protein Information
BAG family molecular chaperone regulator 2
UniProt Protein Name
BAG family molecular chaperone regulator 2
UniProt Gene Name
BAG2
UniProt Synonym Gene Names
BAG-2
UniProt Entry Name
BAG2_HUMAN

NCBI Description

BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The predicted BAG2 protein contains 211 amino acids. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008]

Uniprot Description

BAG2: Inhibits the chaperone activity of HSP70/HSC70 by promoting substrate release.

Protein type: Apoptosis

Chromosomal Location of Human Ortholog: 6p12.1-p11.2

Cellular Component: cytosol

Molecular Function: adenyl-nucleotide exchange factor activity; identical protein binding; protein binding

Biological Process: protein folding; protein metabolic process

Research Articles on BAG2

Similar Products

Product Notes

The BAG2 bag2 (Catalog #AAA1269691) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCTCAGG CGAAGATCAA CGCTAAAGCC AACGAGGGGC GCTTCTGCCG CTCCTCCTCC ATGGCTGACC GCTCCAGCCG CCTGCTGGAG AGCCTGGACC AGCTGGAGCT CAGGGTTGAA GCTTTGAGAG AAGCAGCAAC TGCTGTTGAG CAAGAGAAAG AAATCCTTCT GGAAATGATC CACAGTATCC AAAATAGCCA GGACATGAGG CAGATCAGTG ACGGAGAAAG AGAAGAATTA AATCTGACTG CAAACCGTTT GATGGGAAGA ACTCTCACCG TTGAAGTGTC AGTAGAAACA ATTAGAAACC CCCAGCAGCA AGAATCCCTA AAGCATGCCA CAAGGATTAT TGATGAGGTG GTCAATAAGT TTCTGGATGA TTTGGGAAAT GCCAAGAGTC ATTTAATGTC GCTCTACAGT GCATGTTCAT CTGAGGTGCC ACATGGGCCA GTTGATCAGA AGTTTCAATC CATAGTAATT GGCTGTGCTC TTGAAGATCA GAAGAAAATT AAGAGAAGAT TAGAGACTCT GCTTAGAAAT ATTGAAAACT CTGACAAGGC CATCAAGCTA TTAGAGCATT CTAAAGGAGC TGGTTCCAAA ACTCTGCAAC AAAATGCTGA AAGCAGATTC AATTAG. It is sometimes possible for the material contained within the vial of "BAG2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.