Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

B3GNT1 cdna clone

B3GNT1 cDNA Clone

Gene Names
B4GAT1; iGAT; iGNT; B3GNT1; B3GNT6; B3GN-T1; MDDGA13; BETA3GNTI
Synonyms
B3GNT1; B3GNT1 cDNA Clone; B3GNT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagatgtcctacgccatccggtgcgccttctaccagctgctgctggccgcgctcatgctggtggcgatgctgcagctgctctacctgtcgctgctgtccggactgcacgggcaggaggagcaagaccaatattttgagttctttcccccgtccccacggtccgtggaccaggtcaaggcgcagctccgcaccgcgctggcctctggaggcgtcctggacgctagcggcgattaccgcgtctacaggggcctgctgaagaccaccatggaccccaacgatgtgatcctggccacgcacgccagcgtggacaacctgctgcacctgtcgggtctgctggagcgctgggagggcccgctgtccgtgtcggtgttcgcggccaccaaggaggaggcgcagctggccacggtgctggcctacgcgctgagcagccactgccccgacatgcgcgccagggtcgccatgcacctcgtgtgcccctcgcgttacgaggcagccgtgcccgacccccgggagccgggggagtttgccctgctgcggtcctgccaggaggtctttgacaagctagccagggtggcccagcccgggattaattatgcgctgggcaccaatgtctcctaccccaataacctgctgaggaatctggctcgtgagggggccaactatgccctggtgatcgatgtggacatggtgcccagcgaggggctgtggagaggcctgcgggaaatgctggatcagagcaaccagtggggaggcaccgcgctggtggtgcctgccttcgaaatccgaagagcccgccgcatgcccatgaacaaaaacgagctggtgcagctctaccaggttggcgaggtgcggcccttctattatgggttgtgcaccccctgccaggcacccaccaactattcccgctgggtcaacctgccggaagagagcttgctgcggcccgcctacgtggtaccttggcaggacccctgggagccattctacgtggcaggaggcaaggtgcccaccttcgacgagcgctttcggcagtacggcttcaaccgaatcagccaggcctgcgagctgcatgtggcggggtttgattttgaggtcctgaacgaaggtttcttggttcataagggcttcaaagaagcgttgaagttccatccccaaaaggaggctgaaaatcagcacaataagatcctatatcgccagttcaaacaggagttgaaggccaagtaccccaactctccccgacgctgctga
Sequence Length
1248
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,119 Da
NCBI Official Full Name
Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1, mRNA
NCBI Official Synonym Full Names
beta-1,4-glucuronyltransferase 1
NCBI Official Symbol
B4GAT1
NCBI Official Synonym Symbols
iGAT; iGNT; B3GNT1; B3GNT6; B3GN-T1; MDDGA13; BETA3GNTI
NCBI Protein Information
beta-1,4-glucuronyltransferase 1
UniProt Protein Name
Beta-1,4-glucuronyltransferase 1
UniProt Gene Name
B4GAT1
UniProt Synonym Gene Names
iGnT
UniProt Entry Name
B4GA1_HUMAN

NCBI Description

This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II transmembrane protein. It is essential for the synthesis of poly-N-acetyllactosamine, a determinant for the blood group i antigen. [provided by RefSeq, Jul 2008]

Uniprot Description

B4GAT1: Can initiate the synthesis or the elongation of the linear poly-N-acetyllactosaminoglycans.

Protein type: Glycan Metabolism - glycosphingolipid biosynthesis - lacto and neolacto series; Glycan Metabolism - keratan sulfate biosynthesis; EC 2.4.1.149; Transferase; Membrane protein, integral

Chromosomal Location of Human Ortholog: 11q13.2

Cellular Component: Golgi apparatus; Golgi membrane

Molecular Function: glucuronosyltransferase activity; N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity

Biological Process: keratan sulfate biosynthetic process; poly-N-acetyllactosamine biosynthetic process; protein amino acid O-linked mannosylation

Disease: Muscular Dystrophy-dystroglycanopathy (congenital With Brain And Eye Anomalies), Type A, 13

Research Articles on B3GNT1

Similar Products

Product Notes

The B3GNT1 b4gat1 (Catalog #AAA1269699) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagatgt cctacgccat ccggtgcgcc ttctaccagc tgctgctggc cgcgctcatg ctggtggcga tgctgcagct gctctacctg tcgctgctgt ccggactgca cgggcaggag gagcaagacc aatattttga gttctttccc ccgtccccac ggtccgtgga ccaggtcaag gcgcagctcc gcaccgcgct ggcctctgga ggcgtcctgg acgctagcgg cgattaccgc gtctacaggg gcctgctgaa gaccaccatg gaccccaacg atgtgatcct ggccacgcac gccagcgtgg acaacctgct gcacctgtcg ggtctgctgg agcgctggga gggcccgctg tccgtgtcgg tgttcgcggc caccaaggag gaggcgcagc tggccacggt gctggcctac gcgctgagca gccactgccc cgacatgcgc gccagggtcg ccatgcacct cgtgtgcccc tcgcgttacg aggcagccgt gcccgacccc cgggagccgg gggagtttgc cctgctgcgg tcctgccagg aggtctttga caagctagcc agggtggccc agcccgggat taattatgcg ctgggcacca atgtctccta ccccaataac ctgctgagga atctggctcg tgagggggcc aactatgccc tggtgatcga tgtggacatg gtgcccagcg aggggctgtg gagaggcctg cgggaaatgc tggatcagag caaccagtgg ggaggcaccg cgctggtggt gcctgccttc gaaatccgaa gagcccgccg catgcccatg aacaaaaacg agctggtgca gctctaccag gttggcgagg tgcggccctt ctattatggg ttgtgcaccc cctgccaggc acccaccaac tattcccgct gggtcaacct gccggaagag agcttgctgc ggcccgccta cgtggtacct tggcaggacc cctgggagcc attctacgtg gcaggaggca aggtgcccac cttcgacgag cgctttcggc agtacggctt caaccgaatc agccaggcct gcgagctgca tgtggcgggg tttgattttg aggtcctgaa cgaaggtttc ttggttcata agggcttcaa agaagcgttg aagttccatc cccaaaagga ggctgaaaat cagcacaata agatcctata tcgccagttc aaacaggagt tgaaggccaa gtaccccaac tctccccgac gctgctga. It is sometimes possible for the material contained within the vial of "B3GNT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.