Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AURKB cdna clone

AURKB cDNA Clone

Gene Names
AURKB; AIK2; AIM1; ARK2; AurB; IPL1; STK5; AIM-1; STK12; PPP1R48; aurkb-sv1; aurkb-sv2
Synonyms
AURKB; AURKB cDNA Clone; AURKB cdna clone
Ordering
For Research Use Only!
Sequence
atggcccagaaggagaactcctacccctggccctacggccgacagacggctccatctggcctgagcaccctgccccagcgagtcctccggaaagagcctgtcaccccatctgcacttgtcctcatgagccgctccaatgtccagcccacagctgcccctggccagaaggtgatggagaatagcagtgggacacccgacatcttaacgcggcacttcacaattgatgactttgagattgggcgtcctctgggcaaaggcaagtttggaaacgtgtacttggctcgggagaagaaaagccatttcatcgtggcgctcaaggtcctcttcaagtcccagatagagaaggagggcgtggagcatcagctgcgcagagagatcgaaatccaggcccacctgcaccatcccaacatcctgcgtctctacaactatttttatgaccggaggaggatctacttgattctagagtatgccccccgcggggagctctacaaggagctgcagaagagctgcacatttgacgagcagcgaacagccacgatcatggaggagttggcagatgctctaatgtactgccatgggaagaaggtgattcacagagacataaagccagaaaatctgctcttagggctcaagggagagctgaagattgctgacttcggctggtctgtgcatgcgccctccctgaggaggaagacaatgtgtggcaccctggactacctgcccccagagatgattgaggggcgcatgcacaatgagaaggtggatctgtggtgcattggagtgctttgctatgagctgctggtggggaacccaccctttgagagtgcatcacacaacgagacctatcgccgcatcgtcaaggtggacctaaagttccccgcttccgtgcccatgggagcccaggacctcatctccaaactgctcaggcataacccctcggaacggctgcccctggcccaggtctcagcccacccttgggtccgggccaactctcggagggtgctgcctccctctgcccttcaatctgtcgcctga
Sequence Length
1035
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,467 Da
NCBI Official Full Name
Homo sapiens aurora kinase B, mRNA
NCBI Official Synonym Full Names
aurora kinase B
NCBI Official Symbol
AURKB
NCBI Official Synonym Symbols
AIK2; AIM1; ARK2; AurB; IPL1; STK5; AIM-1; STK12; PPP1R48; aurkb-sv1; aurkb-sv2
NCBI Protein Information
aurora kinase B
UniProt Protein Name
Aurora kinase B
Protein Family
UniProt Gene Name
AURKB
UniProt Synonym Gene Names
AIK2; AIM1; AIRK2; ARK2; STK1; STK12; STK5; AIM-1; ARK-2; Aurora-related kinase 2
UniProt Entry Name
AURKB_HUMAN

NCBI Description

This gene encodes a member of the aurora kinase subfamily of serine/threonine kinases. The genes encoding the other two members of this subfamily are located on chromosomes 19 and 20. These kinases participate in the regulation of alignment and segregation of chromosomes during mitosis and meiosis through association with microtubules. A pseudogene of this gene is located on chromosome 8. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]

Uniprot Description

AurB: a member of the AUR family of kinases. May be directly involved in regulating the cleavage of polar spindle microtubules and is a key regulator for the onset of cytokinesis during mitosis. Expressed during S and G2/M phase and expression is upregulated in cancer cells during M phase. Localized to the midzone of central spindle in late anaphase and concentrated into the midbody in telophase and cytokinesis. Colocalizes with gamma tubulin in the mid-body. Component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly. Overexpressed in colorectal and other cancer cell lines and thought to cause aneuploidy via histone phosphorylation.

Protein type: Protein kinase, Other; Kinase, protein; Protein kinase, Ser/Thr (non-receptor); EC 2.7.11.1; Other group; AUR family

Chromosomal Location of Human Ortholog: 17p13.1

Cellular Component: condensed nuclear chromosome, pericentric region; cytosol; intercellular bridge; kinetochore; midbody; nucleoplasm; nucleus; spindle; spindle microtubule; spindle midzone; spindle pole centrosome

Molecular Function: histone serine kinase activity; protein binding; protein serine/threonine kinase activity; protein serine/threonine/tyrosine kinase activity

Biological Process: abscission; anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; attachment of spindle microtubules to kinetochore; histone modification; negative regulation of B cell apoptosis; negative regulation of cytokinesis; negative regulation of protein binding; negative regulation of transcription from RNA polymerase II promoter; positive regulation of cytokinesis; positive regulation of telomerase activity; positive regulation of telomere maintenance via telomerase; protein amino acid autophosphorylation; protein amino acid phosphorylation; protein sumoylation; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of chromosome segregation; sister chromatid cohesion; spindle midzone assembly involved in mitosis; spindle organization and biogenesis

Research Articles on AURKB

Similar Products

Product Notes

The AURKB aurkb (Catalog #AAA1276588) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccaga aggagaactc ctacccctgg ccctacggcc gacagacggc tccatctggc ctgagcaccc tgccccagcg agtcctccgg aaagagcctg tcaccccatc tgcacttgtc ctcatgagcc gctccaatgt ccagcccaca gctgcccctg gccagaaggt gatggagaat agcagtggga cacccgacat cttaacgcgg cacttcacaa ttgatgactt tgagattggg cgtcctctgg gcaaaggcaa gtttggaaac gtgtacttgg ctcgggagaa gaaaagccat ttcatcgtgg cgctcaaggt cctcttcaag tcccagatag agaaggaggg cgtggagcat cagctgcgca gagagatcga aatccaggcc cacctgcacc atcccaacat cctgcgtctc tacaactatt tttatgaccg gaggaggatc tacttgattc tagagtatgc cccccgcggg gagctctaca aggagctgca gaagagctgc acatttgacg agcagcgaac agccacgatc atggaggagt tggcagatgc tctaatgtac tgccatggga agaaggtgat tcacagagac ataaagccag aaaatctgct cttagggctc aagggagagc tgaagattgc tgacttcggc tggtctgtgc atgcgccctc cctgaggagg aagacaatgt gtggcaccct ggactacctg cccccagaga tgattgaggg gcgcatgcac aatgagaagg tggatctgtg gtgcattgga gtgctttgct atgagctgct ggtggggaac ccaccctttg agagtgcatc acacaacgag acctatcgcc gcatcgtcaa ggtggaccta aagttccccg cttccgtgcc catgggagcc caggacctca tctccaaact gctcaggcat aacccctcgg aacggctgcc cctggcccag gtctcagccc acccttgggt ccgggccaac tctcggaggg tgctgcctcc ctctgccctt caatctgtcg cctga. It is sometimes possible for the material contained within the vial of "AURKB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.