Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AURKAIP1 cdna clone

AURKAIP1 cDNA Clone

Gene Names
AURKAIP1; AIP; AKIP; MRP-S38
Synonyms
AURKAIP1; AURKAIP1 cDNA Clone; AURKAIP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctcctggggcgcctgacttcccagctgttgagggccgttccttgggcaggcggccgcccgccttggcccgtctctggagtgctgggcagccgggtctgcgggcccctttacagcacatcgccggccggcccaggtagggcggcctctctccctcgcaagggggcccagctggagctggaggagatgctggtccccaggaagatgtccgtcagccccctggagagctggctcacggcccgctgcttcctgcccagactggataccgggaccgcagggactgtggctccaccgcaatcctaccagtgtccgcccagccagataggggaaggggccgagcagggggatgaaggcgtcgcggatgcgcctcaaattcagtgcaaaaacgtgctgaagatccgccggcggaagatgaaccaccacaagtaccggaagctggtgaagaagacgcggttcctgcggaggaaggtccaggagggacgcctgagacgcaagcagatcaagttcgagaaagacctgaggcgcatctggctgaaggcggggctaaaggaagcccccgaaggctggcagacccccaagatctacctgcggggcaaatga
Sequence Length
600
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,354 Da
NCBI Official Full Name
Homo sapiens aurora kinase A interacting protein 1, mRNA
NCBI Official Synonym Full Names
aurora kinase A interacting protein 1
NCBI Official Symbol
AURKAIP1
NCBI Official Synonym Symbols
AIP; AKIP; MRP-S38
NCBI Protein Information
aurora kinase A-interacting protein
UniProt Protein Name
Aurora kinase A-interacting protein
UniProt Gene Name
AURKAIP1
UniProt Synonym Gene Names
AIP; AKIP; MRPS38; AURKA-interacting protein; MRP-S38
UniProt Entry Name
AKIP_HUMAN

Uniprot Description

AKIP: May act as a negative regulator of Aurora-A kinase, by down-regulation through proteasome-dependent degradation.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 1p36.33

Cellular Component: intracellular membrane-bound organelle; mitochondrial inner membrane; mitochondrion; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: positive regulation of proteolysis

Research Articles on AURKAIP1

Similar Products

Product Notes

The AURKAIP1 aurkaip1 (Catalog #AAA1270646) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcctgg ggcgcctgac ttcccagctg ttgagggccg ttccttgggc aggcggccgc ccgccttggc ccgtctctgg agtgctgggc agccgggtct gcgggcccct ttacagcaca tcgccggccg gcccaggtag ggcggcctct ctccctcgca agggggccca gctggagctg gaggagatgc tggtccccag gaagatgtcc gtcagccccc tggagagctg gctcacggcc cgctgcttcc tgcccagact ggataccggg accgcaggga ctgtggctcc accgcaatcc taccagtgtc cgcccagcca gataggggaa ggggccgagc agggggatga aggcgtcgcg gatgcgcctc aaattcagtg caaaaacgtg ctgaagatcc gccggcggaa gatgaaccac cacaagtacc ggaagctggt gaagaagacg cggttcctgc ggaggaaggt ccaggaggga cgcctgagac gcaagcagat caagttcgag aaagacctga ggcgcatctg gctgaaggcg gggctaaagg aagcccccga aggctggcag acccccaaga tctacctgcg gggcaaatga. It is sometimes possible for the material contained within the vial of "AURKAIP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.