ATPBD4 cdna clone
ATPBD4 cDNA Clone
Gene Names
DPH6; ATPBD4
Synonyms
ATPBD4; ATPBD4 cDNA Clone; ATPBD4 cdna clone
Sequence
atgagggtcgcggctctgatcagtggtgggaaggacagctgctataatatgatgcagtgcattgctgctgggcatcagatcgttgctttagcaaatctaagaccagctgaaaaccaagtggggtctgatgaactggatagctacatgtatcagacagtggggcaccatgccattgacttgtatgcagaagcaatggctcttcccctctatcgccgaaccataagaggaaggagcttggatacaagacaagtgtacaccaaatgtgaaggtgatgaggttgaagatctctatgagcttttgaaacttgttaaggaaaaagaagaagtagaggggatatcagtaggtgctatactttctgactatcagcgtattcgagtggaaaatgtgtgtaaaaggcttaatctccagcctttagcttatctttggcagagaaaccaggaagatttgctcagagagatgatatcatctaacattcaagcaatgatcatcaaagtagcagctttgggtttagatcctgataagcatcttgggaaaaccctggatcaaatggagccttatctcatagagctttctaagaagtatggagtacatgtttgtggagaaggtggagagtatgaaactttcactttggattgccctctatttaagaagaaaataattgtggattcatcagaagtagtcatacattcagctgatgcatttgcacctgtggcttatctacgctttttagaattgcacttggaggacaaggtgtcctcagtgcctgacaactacagaacatctaattatatatataatttttga
Sequence Length
804
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
18,657 Da
NCBI Official Full Name
Homo sapiens ATP binding domain 4, mRNA
NCBI Official Synonym Full Names
diphthamine biosynthesis 6
NCBI Official Symbol
DPH6
NCBI Official Synonym Symbols
ATPBD4
NCBI Protein Information
diphthine--ammonia ligase
UniProt Protein Name
Diphthine--ammonia ligase
UniProt Gene Name
DPH6
UniProt Synonym Gene Names
ATPBD4
UniProt Entry Name
DPH6_HUMAN
Uniprot Description
DPH6: Amidase that catalyzes the last step of diphthamide biosynthesis using ammonium and ATP. Diphthamide biosynthesis consists in the conversion of an L-histidine residue in the translation elongation factor (EEF2) to diphthamide. Belongs to the Diphthine--ammonia ligase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 6.3.1.14
Chromosomal Location of Human Ortholog: 15q14
Cellular Component: cytosol; nucleolus; nucleus
Molecular Function: diphthine-ammonia ligase activity
Biological Process: peptidyl-diphthamide biosynthetic process from peptidyl-histidine; regulation of protein stability
Research Articles on ATPBD4
Similar Products
Product Notes
The ATPBD4 dph6 (Catalog #AAA1271551) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagggtcg cggctctgat cagtggtggg aaggacagct gctataatat gatgcagtgc attgctgctg ggcatcagat cgttgcttta gcaaatctaa gaccagctga aaaccaagtg gggtctgatg aactggatag ctacatgtat cagacagtgg ggcaccatgc cattgacttg tatgcagaag caatggctct tcccctctat cgccgaacca taagaggaag gagcttggat acaagacaag tgtacaccaa atgtgaaggt gatgaggttg aagatctcta tgagcttttg aaacttgtta aggaaaaaga agaagtagag gggatatcag taggtgctat actttctgac tatcagcgta ttcgagtgga aaatgtgtgt aaaaggctta atctccagcc tttagcttat ctttggcaga gaaaccagga agatttgctc agagagatga tatcatctaa cattcaagca atgatcatca aagtagcagc tttgggttta gatcctgata agcatcttgg gaaaaccctg gatcaaatgg agccttatct catagagctt tctaagaagt atggagtaca tgtttgtgga gaaggtggag agtatgaaac tttcactttg gattgccctc tatttaagaa gaaaataatt gtggattcat cagaagtagt catacattca gctgatgcat ttgcacctgt ggcttatcta cgctttttag aattgcactt ggaggacaag gtgtcctcag tgcctgacaa ctacagaaca tctaattata tatataattt ttga. It is sometimes possible for the material contained within the vial of "ATPBD4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
