Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATP6V0B cdna clone

ATP6V0B cDNA Clone

Gene Names
ATP6V0B; ATP6F; HATPL; VMA16
Synonyms
ATP6V0B; ATP6V0B cDNA Clone; ATP6V0B cdna clone
Ordering
For Research Use Only!
Sequence
atgacggggctagcactgctctactccggggtcttcgtggccttctgggcctgcgcgctggccgtgggagtctgctacaccatttttgatttgggcttccgctttgatgtggcatggttcctgacggagacttcgcccttcatgtggtccaacctgggcattggcctagctatctccctgtctgtggttggggcagcctggggcatctatattaccggctcctccatcattggtggaggagtgaaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggctgtggccatctacggcatcatcatggcaattgtcattagcaacatggctgagcctttcagtgccacagaccccaaggccatcggccatcggaactaccatgcaggctactccatgtttggggctggcctcaccgtaggcctgtctaacctcttctgtggagtctgcgtgggcatcgtgggcagtggggctgccctggccgatgctcagaaccccagcctctttgtaaagattctcatcgtggagatctttggcagcgccattggcctctttggggtcatcgtcgcaattcttcagacctccagagtgaagatgggtgactag
Sequence Length
618
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
533
Molecular Weight
16,206 Da
NCBI Official Full Name
Homo sapiens ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b, mRNA
NCBI Official Synonym Full Names
ATPase H+ transporting V0 subunit b
NCBI Official Symbol
ATP6V0B
NCBI Official Synonym Symbols
ATP6F; HATPL; VMA16
NCBI Protein Information
V-type proton ATPase 21 kDa proteolipid subunit
UniProt Protein Name
V-type proton ATPase 21 kDa proteolipid subunit
Protein Family
UniProt Gene Name
ATP6V0B
UniProt Synonym Gene Names
ATP6F; V-ATPase 21 kDa proteolipid subunit
UniProt Entry Name
VATO_HUMAN

NCBI Description

This gene encodes a portion of the V0 domain of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. Activity of this enzyme is necessary for such varied processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

Uniprot Description

ATP6V0B: Proton-conducting pore forming subunit of the membrane integral V0 complex of vacuolar ATPase. V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells. Belongs to the V-ATPase proteolipid subunit family.

Protein type: Membrane protein, integral; Transporter; Transporter, iron; Transporter, ion channel; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 1p32.3

Cellular Component: endosome membrane; phagocytic vesicle membrane

Molecular Function: hydrogen ion transporting ATPase activity, rotational mechanism; transporter activity

Biological Process: insulin receptor signaling pathway; proton transport; transferrin transport; vacuolar acidification

Research Articles on ATP6V0B

Similar Products

Product Notes

The ATP6V0B atp6v0b (Catalog #AAA1271737) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacggggc tagcactgct ctactccggg gtcttcgtgg ccttctgggc ctgcgcgctg gccgtgggag tctgctacac catttttgat ttgggcttcc gctttgatgt ggcatggttc ctgacggaga cttcgccctt catgtggtcc aacctgggca ttggcctagc tatctccctg tctgtggttg gggcagcctg gggcatctat attaccggct cctccatcat tggtggagga gtgaaggccc ccaggatcaa gaccaagaac ctggtcagca tcatcttctg tgaggctgtg gccatctacg gcatcatcat ggcaattgtc attagcaaca tggctgagcc tttcagtgcc acagacccca aggccatcgg ccatcggaac taccatgcag gctactccat gtttggggct ggcctcaccg taggcctgtc taacctcttc tgtggagtct gcgtgggcat cgtgggcagt ggggctgccc tggccgatgc tcagaacccc agcctctttg taaagattct catcgtggag atctttggca gcgccattgg cctctttggg gtcatcgtcg caattcttca gacctccaga gtgaagatgg gtgactag. It is sometimes possible for the material contained within the vial of "ATP6V0B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.