Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATMIN cdna clone

ATMIN cDNA Clone

Gene Names
ATMIN; ASCIZ; ZNF822
Synonyms
ATMIN; ATMIN cDNA Clone; ATMIN cdna clone
Ordering
For Research Use Only!
Sequence
atgaaaatgcatgctgagaagaagcacaaatgtagtaagtgcagcaattcgtacggtacagaatgggacctgaaaagacatgcagaggactgtggcaagaccttccggtgcacatgcggctgtccctacgccagtagaacagcactgcagtctcacatctaccgaactgggcacgagatacctgcagaacacagggacccacctagtaagaaaaggaaaatggaaaactgtgcacaaaaccagaagttatccaacaagaccattgaatcattgaacaaccaaccaatccctagaccagacactcaagaactagaagcttcagaaataaagctagaaccatcttttgaagactcttgtggctctaacactgacaagcagactcttacaacaccaccgaggtatcctcagaagttgcttttaccaaagcccaaagtggctttggttaaactacccgtgatgcagttttctgtcatgcctgtctttgtgcctacagccgactcctcagcccagcctgtggtgttaggtgttgatcagggctctgccacaggggctgtgcacttaatgcccttgtcagtaggaaccctgatcctcggcctagattcagaggcttgctctcttaaggagagcctacctcttttcaaaattgctaatcctattgctggtgagccaataagtactggtgttcaagtgaactttggtaaaagtccatctaatcctttacaagaactagggaacacgtgtcaaaagaatagcatttcttcaatcaacgtgcagacagatctgtcttatgcctcacaaaactttataccttctgcacagtgggccactgctgattcctctgtgtcgtcttgttctcaaactgatttgtcgtttgattctcaagtgtctcttcccattagtgttcacactcagacatttttgcccagctctaaggtaacttcatctatagctgctcagactgatgcatttatggacacctgtttccagtcaggtggggtctccagagaaactcaaaccagtgggatagaaagtccaacggatgaccatgtacagatggaccaagctggaatgtgcggagacatttttgagagtgttcattcatcatataatgttgctacaggtaacattataagcaacagtttagtagcagagacagtaactcatagtttgttacctcagaatgagcctaagactttaaatcaagatattgagaaatctgcaccaattataaatttcagtgcacagaatagtatgcttccttcacagaacatgacagataatcagacccaaaccatagatttattaagtgatttggaaaacatcttgtcaagtaatctgcctgcccagacattggatcatcgtagtcttttgtctgacacaaatcctggacctgacacccagctcccatctggcccagcccagaaccccggaatcgattttgatatcgaagagttcttttcggcctcaaatatccagactcaaactgaagagagtgaacttagcaccatgaccaccgagccagtcttggagtcactggacatagagactcaaacggacttcttactcgcagatacctctgctcagtcctatgggtgtaggggaaattctaacttcttaggccttgagatgtttgacacacagacacagacagacttaaactttttcttagacagtagccctcatctgcctctgggaagtattctgaaacactccagcttttccgtgagtactgattcatctgacacagagacccaaactgaaggagtctccactgctaaaaatatacctgctctagaaagcaaagttcagttgaacagtacagaaacacagaccatgagttctgggtttgaaaccctggggagcttgttcttcaccagcaacgaaactcagacagcaatggatgactttcttctggctgatctggcctggaacacgatggagtctcagttcagctctgtagaaacccagacttctgcggaaccacacacagtctccaacttctaa
Sequence Length
2004
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,334 Da
NCBI Official Full Name
Homo sapiens ATM interactor, mRNA
NCBI Official Synonym Full Names
ATM interactor
NCBI Official Symbol
ATMIN
NCBI Official Synonym Symbols
ASCIZ; ZNF822
NCBI Protein Information
ATM interactor
UniProt Protein Name
ATM interactor
Protein Family
UniProt Gene Name
ATMIN
UniProt Synonym Gene Names
KIAA0431; ZNF822; ASCIZ
UniProt Entry Name
ATMIN_HUMAN

Uniprot Description

ATMIN: Transcription factor. Plays a crucial role in cell survival and RAD51 foci formation in response to methylating DNA damage. Involved in regulating the activity of ATM in the absence of DNA damage. May play a role in stabilizing ATM. Binds to the DYNLL1 promoter and activates its transcription. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein; DNA repair, damage

Chromosomal Location of Human Ortholog: 16q23.2

Cellular Component: nucleus

Molecular Function: dynein binding; protein binding

Biological Process: positive regulation of transcription, DNA-dependent

Research Articles on ATMIN

Similar Products

Product Notes

The ATMIN atmin (Catalog #AAA1272841) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaatgc atgctgagaa gaagcacaaa tgtagtaagt gcagcaattc gtacggtaca gaatgggacc tgaaaagaca tgcagaggac tgtggcaaga ccttccggtg cacatgcggc tgtccctacg ccagtagaac agcactgcag tctcacatct accgaactgg gcacgagata cctgcagaac acagggaccc acctagtaag aaaaggaaaa tggaaaactg tgcacaaaac cagaagttat ccaacaagac cattgaatca ttgaacaacc aaccaatccc tagaccagac actcaagaac tagaagcttc agaaataaag ctagaaccat cttttgaaga ctcttgtggc tctaacactg acaagcagac tcttacaaca ccaccgaggt atcctcagaa gttgctttta ccaaagccca aagtggcttt ggttaaacta cccgtgatgc agttttctgt catgcctgtc tttgtgccta cagccgactc ctcagcccag cctgtggtgt taggtgttga tcagggctct gccacagggg ctgtgcactt aatgcccttg tcagtaggaa ccctgatcct cggcctagat tcagaggctt gctctcttaa ggagagccta cctcttttca aaattgctaa tcctattgct ggtgagccaa taagtactgg tgttcaagtg aactttggta aaagtccatc taatccttta caagaactag ggaacacgtg tcaaaagaat agcatttctt caatcaacgt gcagacagat ctgtcttatg cctcacaaaa ctttatacct tctgcacagt gggccactgc tgattcctct gtgtcgtctt gttctcaaac tgatttgtcg tttgattctc aagtgtctct tcccattagt gttcacactc agacattttt gcccagctct aaggtaactt catctatagc tgctcagact gatgcattta tggacacctg tttccagtca ggtggggtct ccagagaaac tcaaaccagt gggatagaaa gtccaacgga tgaccatgta cagatggacc aagctggaat gtgcggagac atttttgaga gtgttcattc atcatataat gttgctacag gtaacattat aagcaacagt ttagtagcag agacagtaac tcatagtttg ttacctcaga atgagcctaa gactttaaat caagatattg agaaatctgc accaattata aatttcagtg cacagaatag tatgcttcct tcacagaaca tgacagataa tcagacccaa accatagatt tattaagtga tttggaaaac atcttgtcaa gtaatctgcc tgcccagaca ttggatcatc gtagtctttt gtctgacaca aatcctggac ctgacaccca gctcccatct ggcccagccc agaaccccgg aatcgatttt gatatcgaag agttcttttc ggcctcaaat atccagactc aaactgaaga gagtgaactt agcaccatga ccaccgagcc agtcttggag tcactggaca tagagactca aacggacttc ttactcgcag atacctctgc tcagtcctat gggtgtaggg gaaattctaa cttcttaggc cttgagatgt ttgacacaca gacacagaca gacttaaact ttttcttaga cagtagccct catctgcctc tgggaagtat tctgaaacac tccagctttt ccgtgagtac tgattcatct gacacagaga cccaaactga aggagtctcc actgctaaaa atatacctgc tctagaaagc aaagttcagt tgaacagtac agaaacacag accatgagtt ctgggtttga aaccctgggg agcttgttct tcaccagcaa cgaaactcag acagcaatgg atgactttct tctggctgat ctggcctgga acacgatgga gtctcagttc agctctgtag aaacccagac ttctgcggaa ccacacacag tctccaactt ctaa. It is sometimes possible for the material contained within the vial of "ATMIN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.