Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATF3 cdna clone

ATF3 cDNA Clone

Synonyms
ATF3; ATF3 cDNA Clone; ATF3 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgcttcaacacccaggccaggtctctgcctcggaagtgagtgcttctgccatcgtcccctgcctgtcccctcctgggtcactggtgtttgaggattttgctaacctgacgccctttgtcaaggaagagctgaggtttgccatccagaacaagcacctctgccaccggatgtcctctgcgctggaatcagtcactgtcagcgacagacccctcggggtgtccatcacaaaagccgaggtagcccctgaagaagatgaaaggaaaaagaggcgacgagaaagaaataagattgcagctgcaaagtgccgaaacaagaagaaggagaagacggagtgcctgcagaaagagtcggagaagctggaaagtgtgaatgctgaactgaaggctcagattgaggagctcaagaacgagaagcagcatttgatatacatgctcaaccttcatcggcccacgtgtattgtccgggctcagaatgggaggactccagaagatgagagaaacctctttatccaacagataaaagaaggaacattgcagagctaa
Sequence Length
546
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
467
Molecular Weight
14,314 Da
NCBI Official Full Name
Homo sapiens activating transcription factor 3, mRNA
NCBI Official Synonym Full Names
activating transcription factor 3
NCBI Official Symbol
ATF3
NCBI Protein Information
cyclic AMP-dependent transcription factor ATF-3
UniProt Protein Name
Cyclic AMP-dependent transcription factor ATF-3
UniProt Gene Name
ATF3
UniProt Synonym Gene Names
cAMP-dependent transcription factor ATF-3
UniProt Entry Name
ATF3_HUMAN

NCBI Description

This gene encodes a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors. This gene is induced by a variety of signals, including many of those encountered by cancer cells, and is involved in the complex process of cellular stress response. Multiple transcript variants encoding different isoforms have been found for this gene. It is possible that alternative splicing of this gene may be physiologically important in the regulation of target genes. [provided by RefSeq, Apr 2011]

Uniprot Description

ATF-3: This protein binds the cAMP response element (CRE) (consensus: 5'-GTGACGT[AC][AG]-3'), a sequence present in many viral and cellular promoters. Represses transcription from promoters with ATF sites. It may repress transcription by stabilizing the binding of inhibitory cofactors at the promoter. Isoform 2 activates transcription presumably by sequestering inhibitory cofactors away from the promoters. Belongs to the bZIP family. ATF subfamily. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor

Chromosomal Location of Human Ortholog: 1q32.3

Cellular Component: nucleolus; nucleoplasm; nucleus

Molecular Function: identical protein binding; protein binding; protein heterodimerization activity; protein homodimerization activity; transcription corepressor activity; transcription factor activity

Biological Process: negative regulation of transcription from RNA polymerase II promoter; positive regulation of transcription from RNA polymerase II promoter

Research Articles on ATF3

Similar Products

Product Notes

The ATF3 atf3 (Catalog #AAA1274107) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgcttc aacacccagg ccaggtctct gcctcggaag tgagtgcttc tgccatcgtc ccctgcctgt cccctcctgg gtcactggtg tttgaggatt ttgctaacct gacgcccttt gtcaaggaag agctgaggtt tgccatccag aacaagcacc tctgccaccg gatgtcctct gcgctggaat cagtcactgt cagcgacaga cccctcgggg tgtccatcac aaaagccgag gtagcccctg aagaagatga aaggaaaaag aggcgacgag aaagaaataa gattgcagct gcaaagtgcc gaaacaagaa gaaggagaag acggagtgcc tgcagaaaga gtcggagaag ctggaaagtg tgaatgctga actgaaggct cagattgagg agctcaagaa cgagaagcag catttgatat acatgctcaa ccttcatcgg cccacgtgta ttgtccgggc tcagaatggg aggactccag aagatgagag aaacctcttt atccaacaga taaaagaagg aacattgcag agctaa. It is sometimes possible for the material contained within the vial of "ATF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.