Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATF1 cdna clone

ATF1 cDNA Clone

Gene Names
ATF1; TREB36; EWS-ATF1; FUS/ATF-1
Synonyms
ATF1; ATF1 cDNA Clone; ATF1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagattcccacaagagtaccacgtcagagacagcacctcaacctggttcagcagttcagggagctcacatttctcatattgctcaacaggtatcatctttatcagaaagtgaggagtcccaggactcatccgacagcataggctcctcacagaaagcccacgggatcctagcacggcgcccatcttacagaaaaattttgaaagacttatcttctgaagatacacggggcagaaaaggagacggagaaaattctggagtttctgctgctgtcacttctatgtctgttccaactcccatctatcagactagcagcggacagtatattgccattgccccaaatggagccttacagttggcaagtccaggcacagatggagtacagggacttcagacattaaccatgacaaattcaggcagtactcagcaaggtacaactattcttcagtatgcacagacctctgatggacagcagatacttgtgcccagcaatcaggtggtcgtacaaactgcatcaggagatatgcaaacatatcagatccgaactacaccttcagctacttctctgccacaaactgtggtgatgacatctcctgtgactctcacctctcagacaactaagacagatgacccccaattgaaaagagaaataaggttaatgaaaaacagagaagctgctcgagaatgtcgcagaaagaagaaagaatatgtgaaatgcctggaaaaccgagttgcagtcctggaaaatcaaaataaaactctaatagaagagttaaaaactttgaaggatctttattccaataaaagtgtttga
Sequence Length
816
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
466
Molecular Weight
15,295 Da
NCBI Official Full Name
Homo sapiens activating transcription factor 1, mRNA
NCBI Official Synonym Full Names
activating transcription factor 1
NCBI Official Symbol
ATF1
NCBI Official Synonym Symbols
TREB36; EWS-ATF1; FUS/ATF-1
NCBI Protein Information
cyclic AMP-dependent transcription factor ATF-1
UniProt Protein Name
Cyclic AMP-dependent transcription factor ATF-1
UniProt Gene Name
ATF1
UniProt Synonym Gene Names
cAMP-dependent transcription factor ATF-1
UniProt Entry Name
ATF1_HUMAN

NCBI Description

This gene encodes an activating transcription factor, which belongs to the ATF subfamily and bZIP (basic-region leucine zipper) family. It influences cellular physiologic processes by regulating the expression of downstream target genes, which are related to growth, survival, and other cellular activities. This protein is phosphorylated at serine 63 in its kinase-inducible domain by serine/threonine kinases, cAMP-dependent protein kinase A, calmodulin-dependent protein kinase I/II, mitogen- and stress-activated protein kinase and cyclin-dependent kinase 3 (cdk-3). Its phosphorylation enhances its transactivation and transcriptional activities, and enhances cell transformation. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in angiomatoid fibrous histiocytoma and clear cell sarcoma. This gene has a pseudogene on chromosome 6. [provided by RefSeq, Aug 2010]

Uniprot Description

ATF-1: a transcription factor that is a member of the leucine zipper family. Forms a homodimer or heterodimer with c-Jun and stimulates CRE-dependent transcription. Binds the Tax-responsive element (TRE) of HTLV-I. Activated downstream of IL-1. c-Src and TRAF6 are mediators of IL-1-induced AP-1 activation. Plays an important role in the trans-activation of the MHC class II trans-activator (CIITA) promoter III in B cells.

Protein type: Transcription factor

Chromosomal Location of Human Ortholog: 12q13

Cellular Component: nucleoplasm; nucleus

Molecular Function: protein binding; transcription factor activity

Biological Process: positive regulation of transcription from RNA polymerase II promoter

Research Articles on ATF1

Similar Products

Product Notes

The ATF1 atf1 (Catalog #AAA1272059) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagatt cccacaagag taccacgtca gagacagcac ctcaacctgg ttcagcagtt cagggagctc acatttctca tattgctcaa caggtatcat ctttatcaga aagtgaggag tcccaggact catccgacag cataggctcc tcacagaaag cccacgggat cctagcacgg cgcccatctt acagaaaaat tttgaaagac ttatcttctg aagatacacg gggcagaaaa ggagacggag aaaattctgg agtttctgct gctgtcactt ctatgtctgt tccaactccc atctatcaga ctagcagcgg acagtatatt gccattgccc caaatggagc cttacagttg gcaagtccag gcacagatgg agtacaggga cttcagacat taaccatgac aaattcaggc agtactcagc aaggtacaac tattcttcag tatgcacaga cctctgatgg acagcagata cttgtgccca gcaatcaggt ggtcgtacaa actgcatcag gagatatgca aacatatcag atccgaacta caccttcagc tacttctctg ccacaaactg tggtgatgac atctcctgtg actctcacct ctcagacaac taagacagat gacccccaat tgaaaagaga aataaggtta atgaaaaaca gagaagctgc tcgagaatgt cgcagaaaga agaaagaata tgtgaaatgc ctggaaaacc gagttgcagt cctggaaaat caaaataaaa ctctaataga agagttaaaa actttgaagg atctttattc caataaaagt gtttga. It is sometimes possible for the material contained within the vial of "ATF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.