Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATAD1 cdna clone

ATAD1 cDNA Clone

Gene Names
ATAD1; AFDC1; FNP001; THORASE
Synonyms
ATAD1; ATAD1 cDNA Clone; ATAD1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgaaagctcagtttatgagtctctgggatggattggatactgatcacagctgccaggtcatagtaatgggagctaccaatcgtcctcaggaccttgactcggctataatgagaagaatgcctacaagatttcatatcaaccagcctgctttaaaacagagagaagcaatcctgaaactcatcttgaaaaatgaaaatgtggataggcatgtagacctgctagaagttgcccaggaaactgatgggttttcaggaagtgacctaaaagagatgtgtcgagatgctgccctcctctgtgttagagaatatgttaattctacatcagaagaaagccatgacgaagatgaaattcggcctgttcaacagcaggacctgcatcgggcaattgaaaagatgaagaaatcaaaggatgcagcatttcagaatgttttaacacatgtttgtttagattaa
Sequence Length
456
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,408 Da
NCBI Official Full Name
Homo sapiens ATPase family, AAA domain containing 1, mRNA
NCBI Official Synonym Full Names
ATPase family, AAA domain containing 1
NCBI Official Symbol
ATAD1
NCBI Official Synonym Symbols
AFDC1; FNP001; THORASE
NCBI Protein Information
ATPase family AAA domain-containing protein 1
UniProt Protein Name
ATPase family AAA domain-containing protein 1
UniProt Gene Name
ATAD1
UniProt Entry Name
ATAD1_HUMAN

Uniprot Description

ATAD1: ATPase that plays a critical role in regulating the surface expression of AMPA receptors (AMPAR), thereby regulating synaptic plasticity and learning and memory. Required for NMDA- stimulated AMPAR internalization and inhibition of GRIA1 and GRIA2 recycling back to the plasma membrane; these activities are ATPase-dependent. Belongs to the AAA ATPase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; Mitochondrial; EC 3.6.1.3

Chromosomal Location of Human Ortholog: 10q23.31

Cellular Component: membrane; nucleus; peroxisomal membrane; postsynaptic membrane

Molecular Function: ATPase activity; microtubule-severing ATPase activity

Biological Process: cytoplasmic microtubule organization and biogenesis; learning; memory; negative regulation of synaptic transmission, glutamatergic; positive regulation of receptor internalization

Research Articles on ATAD1

Similar Products

Product Notes

The ATAD1 atad1 (Catalog #AAA1274322) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgaaag ctcagtttat gagtctctgg gatggattgg atactgatca cagctgccag gtcatagtaa tgggagctac caatcgtcct caggaccttg actcggctat aatgagaaga atgcctacaa gatttcatat caaccagcct gctttaaaac agagagaagc aatcctgaaa ctcatcttga aaaatgaaaa tgtggatagg catgtagacc tgctagaagt tgcccaggaa actgatgggt tttcaggaag tgacctaaaa gagatgtgtc gagatgctgc cctcctctgt gttagagaat atgttaattc tacatcagaa gaaagccatg acgaagatga aattcggcct gttcaacagc aggacctgca tcgggcaatt gaaaagatga agaaatcaaa ggatgcagca tttcagaatg ttttaacaca tgtttgttta gattaa. It is sometimes possible for the material contained within the vial of "ATAD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.