Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ASB7 cdna clone

ASB7 cDNA Clone

Synonyms
ASB7; ASB7 cDNA Clone; ASB7 cdna clone
Ordering
For Research Use Only!
Sequence
atgttacaccatcattgtcgaaggaaccctgagctccaggaagagttgcagattcaggccgcggtggctgctggggatgtccacacagtgcgaaagatgctagaacaaggctattccccgaatggccgagatgcgaatggctggactctgcttcatttctctgcagcaagaggaaaggaaagatgtgttcgggtttttctagaacacggagctgatcctacagttaaagacttaatcggaggcttcacggctcttcactatgcagccatgcatggccgggcccgcattgcacgcttgatgttagaatctgaatacaggagcgacatcattaatgcaaaaagcaatgacggctggactcccctccatgtggctgcccactacggcagggactcatttgtccggctcctcctggagttcaaggctgaggttgacccactcagtgataaaggtaccacaccgcttcagctcgccattatccgagagaggtcaagctgtgtgaaaatcctcctggaccacaatgccaacatcgacattcagaatggtttcctgttgcgatacgccgtgatcaaaagcaatcactcttattgccgaatgttccttcagagaggggcagacacaaacttgggtcgcttagaagacggacagactcctttacacttatctgcccttagggatgatgtgctgtgtgcacggatgttatataattacggagcagacacgaacacacggaactatgaaggacagaccccattggctgtttcaataagtatttctggaagtagtcgaccatgtttggatttcttacaagaagtcacaagtatgtaa
Sequence Length
825
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,713 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and SOCS box-containing 7, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and SOCS box containing 7
NCBI Official Symbol
ASB7
NCBI Protein Information
ankyrin repeat and SOCS box protein 7
UniProt Protein Name
Ankyrin repeat and SOCS box protein 7
UniProt Gene Name
ASB7
UniProt Synonym Gene Names
ASB-7
UniProt Entry Name
ASB7_HUMAN

NCBI Description

The protein encoded by this gene belongs to a family of ankyrin repeat proteins that, along with four other protein families, contains a C-terminal SOCS box motif. Growing evidence suggests that the SOCS box acts as a bridge between specific substrate-binding domains and the more generic proteins that comprise a large family of E3 ubiquitin protein ligases. In this way, SOCS box containing proteins may regulate protein turnover by targeting proteins for polyubiquination and, therefore, for proteasome-mediated degradation. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

ASB7: Probable substrate-recognition component of a SCF-like ECS (Elongin-Cullin-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 15q26.3

Molecular Function: protein binding

Similar Products

Product Notes

The ASB7 asb7 (Catalog #AAA1270021) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttacacc atcattgtcg aaggaaccct gagctccagg aagagttgca gattcaggcc gcggtggctg ctggggatgt ccacacagtg cgaaagatgc tagaacaagg ctattccccg aatggccgag atgcgaatgg ctggactctg cttcatttct ctgcagcaag aggaaaggaa agatgtgttc gggtttttct agaacacgga gctgatccta cagttaaaga cttaatcgga ggcttcacgg ctcttcacta tgcagccatg catggccggg cccgcattgc acgcttgatg ttagaatctg aatacaggag cgacatcatt aatgcaaaaa gcaatgacgg ctggactccc ctccatgtgg ctgcccacta cggcagggac tcatttgtcc ggctcctcct ggagttcaag gctgaggttg acccactcag tgataaaggt accacaccgc ttcagctcgc cattatccga gagaggtcaa gctgtgtgaa aatcctcctg gaccacaatg ccaacatcga cattcagaat ggtttcctgt tgcgatacgc cgtgatcaaa agcaatcact cttattgccg aatgttcctt cagagagggg cagacacaaa cttgggtcgc ttagaagacg gacagactcc tttacactta tctgccctta gggatgatgt gctgtgtgca cggatgttat ataattacgg agcagacacg aacacacgga actatgaagg acagacccca ttggctgttt caataagtat ttctggaagt agtcgaccat gtttggattt cttacaagaa gtcacaagta tgtaa. It is sometimes possible for the material contained within the vial of "ASB7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.