Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ASB13 cdna clone

ASB13 cDNA Clone

Synonyms
ASB13; ASB13 cDNA Clone; ASB13 cdna clone
Ordering
For Research Use Only!
Sequence
atggagccccgggcggcggacggctgcttcctgggcgacgtgggtttctgggtggagcggacccctgtgcacgaggcagcccagcggggtgagagcctgcagctgcaacagctgatcgagagcggcgcctgcgtgaaccaggtcaccgtggactccatcacgcccctgcacgcagccagtctgcagggccaggcgcggtgtgtgcagctgctgctggcggctggggcccaggtggatgctcgcaacatcgacggcagcaccccgctctgcgatgcctgcgcctcgggcagcatcgagtgtgtgaagctcttgctgtcctacggggccaaggtcaaccctcccctgtacacagcgtcccccctgcacgaggcctgcatgagcgggagttccgaatgtgtgaggcttcttattgacgtcggggccaatctggaagcgcacgattgccattttgggacccctctgcacgttgcctgtgcccgggagcatctggactgtgtcaaagtgctgctcaatgcagcttga
Sequence Length
522
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,205 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and SOCS box-containing 13, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and SOCS box containing 13
NCBI Official Symbol
ASB13
NCBI Protein Information
ankyrin repeat and SOCS box protein 13
UniProt Protein Name
Ankyrin repeat and SOCS box protein 13
UniProt Gene Name
ASB13
UniProt Synonym Gene Names
ASB-13
UniProt Entry Name
ASB13_HUMAN

NCBI Description

The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants, both protein-coding and not protein-coding, have been described for this gene. [provided by RefSeq, Nov 2010]

Uniprot Description

ASB13: May be a substrate-recognition component of a SCF-like ECS (Elongin-Cullin-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 10p15.1

Molecular Function: protein binding

Research Articles on ASB13

Similar Products

Product Notes

The ASB13 asb13 (Catalog #AAA1276305) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcccc gggcggcgga cggctgcttc ctgggcgacg tgggtttctg ggtggagcgg acccctgtgc acgaggcagc ccagcggggt gagagcctgc agctgcaaca gctgatcgag agcggcgcct gcgtgaacca ggtcaccgtg gactccatca cgcccctgca cgcagccagt ctgcagggcc aggcgcggtg tgtgcagctg ctgctggcgg ctggggccca ggtggatgct cgcaacatcg acggcagcac cccgctctgc gatgcctgcg cctcgggcag catcgagtgt gtgaagctct tgctgtccta cggggccaag gtcaaccctc ccctgtacac agcgtccccc ctgcacgagg cctgcatgag cgggagttcc gaatgtgtga ggcttcttat tgacgtcggg gccaatctgg aagcgcacga ttgccatttt gggacccctc tgcacgttgc ctgtgcccgg gagcatctgg actgtgtcaa agtgctgctc aatgcagctt ga. It is sometimes possible for the material contained within the vial of "ASB13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.