Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ARMC10 cdna clone

ARMC10 cDNA Clone

Gene Names
ARMC10; SVH; PNAS112; PNAS-112; PSEC0198
Synonyms
ARMC10; ARMC10 cDNA Clone; ARMC10 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtggcccccggggcgcgggctgggtggcggcgggcctgctgctcggcgcgggcgcctgctactgcatttacaggctgacccggggtcggcggcggggcgaccgcgagctcgggatacgctcttcgaagtccgcagaagacttaactgatggttcatatgatgatgttctaaatgctgaacaacttcagaaactcctttacctgctggagtcaacggaggatcctgtaattattgaaagagctttgattactttgggtaacaatgcagccttttcagttaaccaagctattattcgtgaattgggtggtattccaattgttgcaaacaaaatcaaccattccaaccagagtattaaagagaaagctttaaatgcactaaataacctgagtgtgaatgttgaaaatcaaatcaagataaagatatacatcagtcaagtatgtgaggatgtcttctctggttctctgaactctgctgtgcagctggctggactgacattgttgacaaacatgactgttaccaatgaccaccagcacatgcttcacagttacattacagacctgttccaggtgttacttactggaaatggaaacacgaaggtgcaagttttgaaactgcttttgaatttgtctgaaaatccagccatgacagaaggacttctccgtgcccaagtggattcatcattcctttccctttatgacagccacgtagcaaaggagattcttcttcgagtacttacgctatttcagaatataaagaactgcctcaaaatagaaggccatttagctgtgcagcctactttcactgaaggttcattgtttttcctgttacatggagaagaatgtgcccagaaaataagagctttagttgatcaccatgatgcagaggtgaaggaaaaggttgtaacaataatacccaaaatctga
Sequence Length
927
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,757 Da
NCBI Official Full Name
Homo sapiens armadillo repeat containing 10, mRNA
NCBI Official Synonym Full Names
armadillo repeat containing 10
NCBI Official Symbol
ARMC10
NCBI Official Synonym Symbols
SVH; PNAS112; PNAS-112; PSEC0198
NCBI Protein Information
armadillo repeat-containing protein 10
UniProt Protein Name
Armadillo repeat-containing protein 10
UniProt Gene Name
ARMC10
UniProt Synonym Gene Names
SVH
UniProt Entry Name
ARM10_HUMAN

NCBI Description

This gene encodes a protein that contains an armadillo repeat and transmembrane domain. The encoded protein decreases the transcriptional activity of the tumor suppressor protein p53 through direct interaction with the DNA-binding domain of p53, and may play a role in cell growth and survival. Upregulation of this gene may play a role in hepatocellular carcinoma. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Sep 2011]

Uniprot Description

ARMC10: May play a role in cell survival and cell growth. May suppress the transcriptional activity of p53/TP53. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 7q22.1

Research Articles on ARMC10

Similar Products

Product Notes

The ARMC10 armc10 (Catalog #AAA1268564) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtggcc cccggggcgc gggctgggtg gcggcgggcc tgctgctcgg cgcgggcgcc tgctactgca tttacaggct gacccggggt cggcggcggg gcgaccgcga gctcgggata cgctcttcga agtccgcaga agacttaact gatggttcat atgatgatgt tctaaatgct gaacaacttc agaaactcct ttacctgctg gagtcaacgg aggatcctgt aattattgaa agagctttga ttactttggg taacaatgca gccttttcag ttaaccaagc tattattcgt gaattgggtg gtattccaat tgttgcaaac aaaatcaacc attccaacca gagtattaaa gagaaagctt taaatgcact aaataacctg agtgtgaatg ttgaaaatca aatcaagata aagatataca tcagtcaagt atgtgaggat gtcttctctg gttctctgaa ctctgctgtg cagctggctg gactgacatt gttgacaaac atgactgtta ccaatgacca ccagcacatg cttcacagtt acattacaga cctgttccag gtgttactta ctggaaatgg aaacacgaag gtgcaagttt tgaaactgct tttgaatttg tctgaaaatc cagccatgac agaaggactt ctccgtgccc aagtggattc atcattcctt tccctttatg acagccacgt agcaaaggag attcttcttc gagtacttac gctatttcag aatataaaga actgcctcaa aatagaaggc catttagctg tgcagcctac tttcactgaa ggttcattgt ttttcctgtt acatggagaa gaatgtgccc agaaaataag agctttagtt gatcaccatg atgcagaggt gaaggaaaag gttgtaacaa taatacccaa aatctga. It is sometimes possible for the material contained within the vial of "ARMC10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.