ARL3 cdna clone

ARL3

Cat. Num. AAA200711

• Gene Names: ARL3; RP83; ARFL3; JBTS35
• Synonyms: ARL3; ARFL3; ARL3 cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGGGCTTGCTCTCAATTTTGCGCAAGTTGAAAAGTGCACCAGACCAGGAGGTGAGAATACTTCTCCTGGGCTTGGATAATGCTGGCAAGACCACTCTTCTGAAGCAGCTTGCATCTGAAGACATCAGCCACATCACACCTACACAGGGTTTCAACATCAAAAGTGTACAATCACAAGGTTTTAAACTGAATGTATGGGACATTGGTGGACAGAGGAAAATCAGACCATACTGGAAGAATTATTTTGAAAATACCGATATTCTTATATATGTAATCGACAGTGCAGACAGAAAAAGATTTGAAGAGACGGGTCAGGAACTAGCGGAATTACTGGAGGAAGAAAAACTAAGTTGTGTGCCAGTGCTCATCTTTGCTAATAAGCAGGATTTGCTCACAGCAGCCCCTGCCTCTGAAATTGCAGAAGGACTGAACCTGCATACCATCCGCGACCGAGTCTGGCAGATCCAGTCTTGCTCAGCTCTCACAGGAGAGGGCGTTCAGGATGGCATGAACTGGGTCTGCAAAAATGTCAATGCAAAGAAGAAATAA; ; Translation Sequence: MGLLSILRKL KSAPDQEVRI LLLGLDNAGK TTLLKQLASE DISHITPTQG FNIKSVQSQGFKLNVWDIGG QRKIRPYWKN YFENTDILIY VIDSADRKRF EETGQELAEL LEEEKLSCVPVLIFANKQDL LTAAPASEIA EGLNLHTIRD RVWQIQSCSA LTGEGVQDGM NWVCKNVNAKKK
• Sequence Length: 182

• Species: Human
• Chromosome Location: 10q23.3
• OMIM Reference Number: 604695
• cDNA Size: 549bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for ARL3 cdna clone

Small GTP-binding protein which cycles between an inactive GDP-bound and an active GTP-bound form, and the rate of cycling is regulated by guanine nucleotide exchange factors (GEF) and GTPase-activating proteins (GAP). Required for normal cytokinesis and cilia signaling. Requires assistance from GTPase-activating proteins (GAPs) like RP2 and PDE6D, in order to cycle between inactive GDP-bound and active GTP-bound forms. Required for targeting proteins such as NPHP3 to the ciliary membrane by releasing myristoylated NPHP3 from UNC119B cargo adapter into the cilium. Does not act as an allosteric activator of the cholera toxin catalytic subunit.

Product Categories/Family for ARL3 cdna clone

Cancer; Signal Transduction

NCBI and Uniprot Product Information

• NCBI GI #: 4757774
• NCBI GeneID: 403
• NCBI Accession #: NP_004302.1
• NCBI GenBank Nucleotide #: NM_004311.3
• UniProt Accession #: P36405
• NCBI Official Full Name: ADP-ribosylation factor-like protein 3
• NCBI Official Synonym Full Names: ADP ribosylation factor like GTPase 3
• NCBI Official Symbol: ARL3
• NCBI Official Synonym Symbols: RP83; ARFL3; JBTS35
• NCBI Protein Information: ADP-ribosylation factor-like protein 3
• UniProt Protein Name: ADP-ribosylation factor-like protein 3
• Protein Family: ADP-ribosylation factor-like protein
• UniProt Gene Name: ARL3
• UniProt Synonym Gene Names: ARFL3
• UniProt Entry Name: ARL3_HUMAN

NCBI Description

ADP-ribosylation factor-like 3 is a member of the ADP-ribosylation factor family of GTP-binding proteins. ARL3 binds guanine nucleotides but lacks ADP-ribosylation factor activity. [provided by RefSeq, Jul 2008]

Uniprot Description

ARL3: Small GTP-binding protein which cycles between an inactive GDP-bound and an active GTP-bound form, and the rate of cycling is regulated by guanine nucleotide exchange factors (GEF) and GTPase-activating proteins (GAP). Required for normal cytokinesis and cilia signaling. Requires assistance from GTPase- activating proteins (GAPs) like RP2 and PDE6D, in order to cycle between inactive GDP-bound and active GTP-bound forms. Required for targeting proteins such as NPHP3 to the ciliary membrane by releasing myristoylated NPHP3 from UNC119B cargo adapter into the cilium. Does not act as an allosteric activator of the cholera toxin catalytic subunit. Belongs to the small GTPase superfamily. Arf family.

Protein type: Cell cycle regulation; Cytoskeletal; G protein, monomeric, ARF; G protein, monomeric

Chromosomal Location of Human Ortholog: 10q23.3

Cellular Component: Golgi membrane; Golgi apparatus; centrosome; cytoplasmic microtubule; spindle microtubule; midbody; nucleus; photoreceptor connecting cilium

Molecular Function: GTPase activity; protein binding; GDP binding; GTP binding; microtubule binding; metal ion binding

Biological Process: photoreceptor cell development; protein transport; smoothened signaling pathway; metabolic process; organelle organization and biogenesis; small GTPase mediated signal transduction; intraflagellar transport; cytokinesis; post-Golgi vesicle-mediated transport; kidney development