ARL1 cdna clone

ARL1

Cat. Num. AAA200650

• Gene Names: ARL1; ARFL1
• Synonyms: ARL1; ARFL1; ARL1 cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGGGTGGCTTTTTCTCAAGTATATTTTCCAGTCTGTTTGGAACTCGGGAAATGAGAATTTTAATTTTGGGATTAGATGGAGCAGGAAAAACCACAATTTTGTACAGATTACAAGTGGGAGAAGTTGTTACTACTATACCTACCATTGGATTTAATGTAGAGACGGTGACGTACAAAAACCTTAAATTCCAAGTCTGGGATTTAGGAGGACAGACAAGTATCAGGCCATACTGGAGATGTTACTATTCAAACACAGATGCAGTCATTTATGTAGTAGACAGTTGTGACCGAGACCGAATTGGCATTTCCAAATCAGAGTTAGTTGCCATGTTGGAGGAAGAAGAGCTGAGAAAAGCCATTTTAGTGGTGTTTGCAAATAAACAGGACATGGAACAGGCCATGACTTCCTCAGAGATGGCAAATTCACTTGGGTTACCTGCCTTGAAGGACCGAAAATGGCAGATATTCAAAACGTCAGCAACCAAAGGCACCGGCCTTGATGAGGCAATGGAATGGTTAGTTGAAACATTAAAAAGCAGACAGTAA; ; Translation Sequence: MGGFFSSIFS SLFGTREMRI LILGLDGAGK TTILYRLQVG EVVTTIPTIG FNVETVTYKN LKFQVWDLGG QTSIRPYWRC YYSNTDAVIY VVDSCDRDRI GISKSELVAM LEEEELRKAI LVVFANKQDM EQAMTSSEMA NSLGLPALKD RKWQIFKTSA TKGTGLDEAM EWLVETLKSR Q
• Sequence Length: 181

• Species: Human
• Chromosome Location: 12q23.2
• OMIM Reference Number: 603425
• cDNA Size: 546bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for ARL1 cdna clone

ARL encoded by this gene belongs to the ARL (ADP-ribosylation factor-like) family of proteins, which are structurally related to ADP-ribosylation factors (ARFs). ARFs, described as activators of cholera toxin (CT) ADP-ribosyltransferase activity, regulate intracellular vesicular membrane trafficking, and stimulate a phospholipase D (PLD) isoform. Although, ARL proteins were initially thought not to activate CT or PLD, later work showed that they are weak stimulators of PLD and CT in a phospholipid dependent manner. Alternative splicing results in multiple transcript variants encoding different isoforms.

Product Categories/Family for ARL1 cdna clone

Metabolism; Epigenomics (Transcription & Translation); Transportation

NCBI and Uniprot Product Information

• NCBI GI #: 4502227
• NCBI GeneID: 400
• NCBI Accession #: NP_001168.1
• NCBI GenBank Nucleotide #: NM_001177.5
• UniProt Accession #: P40616
• NCBI Official Full Name: ADP-ribosylation factor-like protein 1 isoform 1
• NCBI Official Synonym Full Names: ADP ribosylation factor like GTPase 1
• NCBI Official Symbol: ARL1
• NCBI Official Synonym Symbols: ARFL1
• NCBI Protein Information: ADP-ribosylation factor-like protein 1
• UniProt Protein Name: ADP-ribosylation factor-like protein 1
• Protein Family: ARL14 effector protein
• UniProt Gene Name: ARL1
• UniProt Entry Name: ARL1_HUMAN

NCBI Description

The protein encoded by this gene belongs to the ARL (ADP-ribosylation factor-like) family of proteins, which are structurally related to ADP-ribosylation factors (ARFs). ARFs, described as activators of cholera toxin (CT) ADP-ribosyltransferase activity, regulate intracellular vesicular membrane trafficking, and stimulate a phospholipase D (PLD) isoform. Although, ARL proteins were initially thought not to activate CT or PLD, later work showed that they are weak stimulators of PLD and CT in a phospholipid dependent manner. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]

Uniprot Description

ARL1: GTP-binding protein that has very low efficiency as allosteric activator of the cholera toxin catalytic subunit, an ADP-ribosyltransferase. Can activate phospholipase D with very low efficiency. Important for normal function of the Golgi apparatus. Belongs to the small GTPase superfamily. Arf family.

Protein type: G protein; G protein, monomeric; G protein, monomeric, ARF

Chromosomal Location of Human Ortholog: 12q23.2

Cellular Component: Golgi membrane; Golgi apparatus; cytoplasm; trans-Golgi network

Molecular Function: GTPase activity; protein domain specific binding; GTP binding; metal ion binding; enzyme activator activity

Biological Process: phospholipase D activation; toxin metabolic process; protein localization in Golgi apparatus; small GTPase mediated signal transduction; retrograde transport, endosome to Golgi; Golgi organization and biogenesis; Golgi vesicle transport