Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ARIH2 cdna clone

ARIH2 cDNA Clone

Gene Names
ARIH2; ARI2; TRIAD1
Synonyms
ARIH2; ARIH2 cDNA Clone; ARIH2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcagtggacatgaatagccaggggtctgacagcaatgaagaggactatgacccaaattgtgaggaagaggaagaagaagaagaagacgaccctggggacatagaggactattacgtgggagtagccagcgatgtggagcagcagggggctgatgcctttgatcccgaggagtaccagttcacttgcttgacctacaaggaatctgagggtgccctcaatgagcacatgaccagcttagcttctgtcctaaaggtatctcattcagttgctaaacttatattagttaatttccactggcaagtttcagagatattggacagatacaagtccaattctgctcaactgcttgttgaggctcgagttcagcctaatccatcaaaacatgttcccacatcccatccccctcaccactgtgcagtgtgtatgcagtttgtgcgaaaggaaaacctactctctctggcctgtcagcaccagttttgccgcagctgctgggagcagcactgctcagttctcgtcaaggacggcgtgggcgtgggagtctcttgcatggctcaggactgtccactccgtacaccagaggactttgtgtttccattgcttcccaatgaagaattgagagagaaatacaggcgctacctcttcagggactatgtggagagtcattaccagctccagctgtgccctggtgcagactgccccatggttattcgggtacaggagcctagagctcgccgagtacagtgcaatcggtgcaacgaggtcttctgtttcaagtgtcgtcagatgtatcacgcacccacagactgtgccacaatccggaaatggctcacgaagtgtgcagacgactctgaaacagccaactacattagtgctcacactaaagactgtcccaagtgcaacatctgcattgagaagaatggaggctgcaatcacatgcaatgctccaaatgtaaacacgacttctgctggatgtgtctaggagattggaagactcatggcagtgaatactatgagtgcagtcgttacaaggagaatcctgacatcgtgaaccagagccaacaagcccaggcgagggaagccctcaagaagtacttattctactttgagaggtgggaaaaccacaataaaagcttgcagctagaggcacagacataccagcggattcacgagaagattcaggagagggtcatgaacaatctggggacatggatcgactggcagtacctacagaatgctgccaagctcttggccaagtgtcgatacaccctgcaatacacctacccatatgcatattacatggagtccggacccaggaagaagctgtttgaataccagcaggctcagctggaggctgagatcgaaaacctctcatggaaagtggagcgtgcagacagctatgacagaggggacttggagaaccagatgcatatagcggagcagcggaggagaaccctgctgaaagatttccatgacacctaa
Sequence Length
1482
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,819 Da
NCBI Official Full Name
Homo sapiens ariadne homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
ariadne RBR E3 ubiquitin protein ligase 2
NCBI Official Symbol
ARIH2
NCBI Official Synonym Symbols
ARI2; TRIAD1
NCBI Protein Information
E3 ubiquitin-protein ligase ARIH2
UniProt Protein Name
E3 ubiquitin-protein ligase ARIH2
UniProt Gene Name
ARIH2
UniProt Synonym Gene Names
ARI2; TRIAD1; ARI-2; Protein ariadne-2 homolog
UniProt Entry Name
ARI2_HUMAN

NCBI Description

The protein encoded by this gene is an E3 ubiquitin-protein ligase that polyubiquitinates some proteins, tagging them for degradation. The encoded protein upregulates p53 in some cancer cells and may inhibit myelopoiesis. Several transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been determined yet. [provided by RefSeq, Nov 2015]

Uniprot Description

ARIH2: E3 ubiquitin-protein ligase mediating 'Lys-48'-and 'Lys- 63'-linked polyubiquitination and subsequent proteasomal degradation of modified proteins. May play a role in myelopoiesis. Belongs to the RBR family. Ariadne subfamily.

Protein type: Ubiquitin ligase; EC 6.3.2.-; Ligase; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 3p21

Cellular Component: cytoplasm; nucleus; ubiquitin ligase complex

Molecular Function: protein binding; ubiquitin conjugating enzyme binding; ubiquitin-protein ligase activity

Biological Process: developmental cell growth; multicellular organismal development; positive regulation of proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process

Research Articles on ARIH2

Similar Products

Product Notes

The ARIH2 arih2 (Catalog #AAA1269608) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagtgg acatgaatag ccaggggtct gacagcaatg aagaggacta tgacccaaat tgtgaggaag aggaagaaga agaagaagac gaccctgggg acatagagga ctattacgtg ggagtagcca gcgatgtgga gcagcagggg gctgatgcct ttgatcccga ggagtaccag ttcacttgct tgacctacaa ggaatctgag ggtgccctca atgagcacat gaccagctta gcttctgtcc taaaggtatc tcattcagtt gctaaactta tattagttaa tttccactgg caagtttcag agatattgga cagatacaag tccaattctg ctcaactgct tgttgaggct cgagttcagc ctaatccatc aaaacatgtt cccacatccc atccccctca ccactgtgca gtgtgtatgc agtttgtgcg aaaggaaaac ctactctctc tggcctgtca gcaccagttt tgccgcagct gctgggagca gcactgctca gttctcgtca aggacggcgt gggcgtggga gtctcttgca tggctcagga ctgtccactc cgtacaccag aggactttgt gtttccattg cttcccaatg aagaattgag agagaaatac aggcgctacc tcttcaggga ctatgtggag agtcattacc agctccagct gtgccctggt gcagactgcc ccatggttat tcgggtacag gagcctagag ctcgccgagt acagtgcaat cggtgcaacg aggtcttctg tttcaagtgt cgtcagatgt atcacgcacc cacagactgt gccacaatcc ggaaatggct cacgaagtgt gcagacgact ctgaaacagc caactacatt agtgctcaca ctaaagactg tcccaagtgc aacatctgca ttgagaagaa tggaggctgc aatcacatgc aatgctccaa atgtaaacac gacttctgct ggatgtgtct aggagattgg aagactcatg gcagtgaata ctatgagtgc agtcgttaca aggagaatcc tgacatcgtg aaccagagcc aacaagccca ggcgagggaa gccctcaaga agtacttatt ctactttgag aggtgggaaa accacaataa aagcttgcag ctagaggcac agacatacca gcggattcac gagaagattc aggagagggt catgaacaat ctggggacat ggatcgactg gcagtaccta cagaatgctg ccaagctctt ggccaagtgt cgatacaccc tgcaatacac ctacccatat gcatattaca tggagtccgg acccaggaag aagctgtttg aataccagca ggctcagctg gaggctgaga tcgaaaacct ctcatggaaa gtggagcgtg cagacagcta tgacagaggg gacttggaga accagatgca tatagcggag cagcggagga gaaccctgct gaaagatttc catgacacct aa. It is sometimes possible for the material contained within the vial of "ARIH2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.