ARHGEF16 cdna clone

ARHGEF16 cDNA Clone

Gene Names

ARHGEF16; NBR; GEF16

Synonyms

ARHGEF16; ARHGEF16 cDNA Clone; ARHGEF16 cdna clone

Ordering
Cat. Num. AAA1276080 For Research Use Only!

Sequence

atgttcgagatcctcacgtcggagttctcctaccagcacagcctgagcatcctggtggaggagttcctgcagtccaaggagctgcgggcgaccgtgacccagatggagcaccaccacctcttctccaacatcctggatgtcctgggtgccagtcagaggttcttcgaggacctggagcagcggcacaaggcccaggtgctggtcgaggacatcagtgacatcctggaggagcacgctgagaagtacttccacccctacatcgcctactgctccaacgaggtctaccaacagcgcacgctgcagaagctgataagcagcaacgccgccttccgagaggccctgagagagattgagaggcggccggcgtgcgggggcctgcccatgctctccttcctgatcctccccatgcagcgggtgacccggctgcccctcctgatggatacgctctgcctcaagacccagggccactccgaaaggtacaaggctgccagccgtgcactgaaggccatcagcaagctggtgaggcagtgcaacgagggggcccacaggatggagcgcatggagcagatgtacacgctgcacacacagctggacttcagcaaggtcaagtccctcccactgatctccgcctcccggtggctgctgaagcgcggagagctgttcttagtggaagaaaccggactttttcgaaaaattgccagccggccaacgtgctaccttttcctgttcaacgatgtcctggttgtgaccaagaagaagagcgaggagagctacatggtccaggactacgcccagatgaaccacatccaggtagagaagatagagccgtctgagctccctctgcccgggggcggcaaccgtagctcctccgtgccccaccccttccaggtgaccctgcttcgcaacagcgagggccgccaggagcagctcctgctctcctcggactccgcgagtgaccgggcacggtggatcgtggcgctcacacacagtgagagacagtggcagggcctctccagcaaaggagacctgccccaggtggagatcaccaaggccttcttcgcgaagcaagcagacgaggtcacactgcagcaggcggacgtggtcctggttctgcagcaggaggatgggtggctctatggcgagaggctccgggacggagagacgggatggttccccgaggactttgcccgcttcatcaccagccgtgtggccgtggagggcaatgtccgcaggatggagcgtctgcgggtggagacggacgtgtag

Sequence Length

1266

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

12803690

NCBI GeneID

27237

Molecular Weight

48,629 Da

NCBI Official Full Name

Homo sapiens Rho guanine exchange factor (GEF) 16, mRNA

NCBI Official Synonym Full Names

Rho guanine nucleotide exchange factor 16

NCBI Official Symbol

ARHGEF16

NCBI Official Synonym Symbols

NBR; GEF16

NCBI Protein Information

rho guanine nucleotide exchange factor 16

UniProt Protein Name

Rho guanine nucleotide exchange factor 16

Protein Family

Rho guanine nucleotide exchange factor

UniProt Gene Name

ARHGEF16

UniProt Synonym Gene Names

EPHEXIN4; NBR

UniProt Entry Name

ARHGG_HUMAN

NCBI Description

Although the specific function of this protein is not known yet, it is thought to be involved in protein-protein and protein-lipid interactions. [provided by RefSeq, Jul 2008]

Uniprot Description

ARHGEF16: a Rho guanine exchange factor protein that contains 1 DH, 1 PH and 1 SH3 domain.

Protein type: GEFs; Motility/polarity/chemotaxis; GEFs, Rac/Rho

Chromosomal Location of Human Ortholog: 1p36.3

Cellular Component: cell-cell adherens junction; cytosol

Molecular Function: guanyl-nucleotide exchange factor activity; PDZ domain binding; protein binding; receptor tyrosine kinase binding; Rho GTPase binding; Rho guanyl-nucleotide exchange factor activity

Biological Process: positive regulation of apoptosis; regulation of small GTPase mediated signal transduction

Research Articles on ARHGEF16

1. Sixty-four novel structural analogues of Y27632 were synthesized and tested for their ability to persistently inhibit the transformation of NIH3T3 cells by Rho guanidine exchange factor 16 (ARHGEF16) or Ras.

Similar Products

Product Notes

The ARHGEF16 arhgef16 (Catalog #AAA1276080) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcgaga tcctcacgtc ggagttctcc taccagcaca gcctgagcat cctggtggag gagttcctgc agtccaagga gctgcgggcg accgtgaccc agatggagca ccaccacctc ttctccaaca tcctggatgt cctgggtgcc agtcagaggt tcttcgagga cctggagcag cggcacaagg cccaggtgct ggtcgaggac atcagtgaca tcctggagga gcacgctgag aagtacttcc acccctacat cgcctactgc tccaacgagg tctaccaaca gcgcacgctg cagaagctga taagcagcaa cgccgccttc cgagaggccc tgagagagat tgagaggcgg ccggcgtgcg ggggcctgcc catgctctcc ttcctgatcc tccccatgca gcgggtgacc cggctgcccc tcctgatgga tacgctctgc ctcaagaccc agggccactc cgaaaggtac aaggctgcca gccgtgcact gaaggccatc agcaagctgg tgaggcagtg caacgagggg gcccacagga tggagcgcat ggagcagatg tacacgctgc acacacagct ggacttcagc aaggtcaagt ccctcccact gatctccgcc tcccggtggc tgctgaagcg cggagagctg ttcttagtgg aagaaaccgg actttttcga aaaattgcca gccggccaac gtgctacctt ttcctgttca acgatgtcct ggttgtgacc aagaagaaga gcgaggagag ctacatggtc caggactacg cccagatgaa ccacatccag gtagagaaga tagagccgtc tgagctccct ctgcccgggg gcggcaaccg tagctcctcc gtgccccacc ccttccaggt gaccctgctt cgcaacagcg agggccgcca ggagcagctc ctgctctcct cggactccgc gagtgaccgg gcacggtgga tcgtggcgct cacacacagt gagagacagt ggcagggcct ctccagcaaa ggagacctgc cccaggtgga gatcaccaag gccttcttcg cgaagcaagc agacgaggtc acactgcagc aggcggacgt ggtcctggtt ctgcagcagg aggatgggtg gctctatggc gagaggctcc gggacggaga gacgggatgg ttccccgagg actttgcccg cttcatcacc agccgtgtgg ccgtggaggg caatgtccgc aggatggagc gtctgcgggt ggagacggac gtgtag. It is sometimes possible for the material contained within the vial of "ARHGEF16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

ARHGEF16 cdna clone