Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ARAF cdna clone

ARAF cDNA Clone

Gene Names
ARAF; PKS2; A-RAF; ARAF1; RAFA1
Synonyms
ARAF; ARAF cDNA Clone; ARAF cdna clone
Ordering
For Research Use Only!
Sequence
atggagccaccacggggcccccctgccaatggggccgagccatcccgggcagtgggcaccgtcaaagtatacctgcccaacaagcaacgcacggtggtgactgtccgggatggcatgagtgtctacgactctctagacaaggccctgaaggtgcggggtctaaatcaggactgctgtgtggtctaccgactcatcaagggacgaaagacggtcactgcctgggacacagccattgctcccctggatggcgaggagctcattgtcgaggtccttgaagatgtcccgctgaccatgcacaattttgtacggaagaccttcttcagcctggcgttctgtgacttctgccttaagtttctgttccatggcttccgttgccaaacctgtggctacaagttccaccagcattgttcctccaaggtccccacagtctgtgttgacatgagtaccaaccgccaacagccctcaaggttctaccacagtgtccaggatttgtccggaggctccagacagcatgaggctccctcgaaccgccccctgaatgagttgctaaccccccagggtcccagcccccgcacccagcactgtgacccggagcacttccccttccctgccccagccaatgcccccctacagcgcatccgctccacgtccactcccaacgtccatatggtcagcaccacggcccccatggactccaacctcatccagctcactggccagagtttcagcactgatgctgccggtagtagaggaggtagtgatggaaccccccgggggagccccagcccagccagcgtgtcctcggggaggaagtccccacattccaagtcaccagcagagcagcgcgagcggaagtccttggccgatgacaagaagaaagtgaagaacctggggtaccgggactcaggctattactgggaggtaccacccagtgaggtgcagctgctgaagaggatcgggacgggctcgtttggcaccgtgtttcgagggcggtggcatggcgatgtggccgtgaaggtgctcaaggtgtcccagcccacagctgagcaggcccaggctttcaagaatgagatgcaggtgctcaggaagacgcgacatgtcaacatcttgctgtttatgggcttcatgacccggccgggatttgccatcatcacacagtggtgtgagggctccagcctctaccatcacctgcatgtggccgacacacgcttcgacatggtccagctcatcgacgtggcccggcagactgcccagggcatggactacctccatgccaagaacatcatccaccgagatctcaagtctaacaacatcttcctacatgaggggctcacggtgaagatcggtgactttggcttggccacagtgaagactcgatggagcggggcccagcccttggagcagccctcaggatctgtgctgtggatggcagctgaggtgatccgtatgcaggacccgaacccctacagcttccagtcagacgtctatgcctacggggttgtgctctacgagcttatgactggctcactgccttacagccacattggctgccgtgaccagattatctttatggtgggccgtggctatctgtccccggacctcagcaaaatctccagcaactgccccaaggccatgcggcgcctgctgtctgactgcctcaagttccagcgggaggagcggcccctcttcccccagatcctggccacaattgagctgctgcaacggtcactccccaagattgagcggagtgcctcggaaccctccttgcaccgcacccaggccgatgagttgcctgcctgcctactcagcgcagcccgccttgtgccttag
Sequence Length
1830
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
369
Molecular Weight
20,904 Da
NCBI Official Full Name
Homo sapiens v-raf murine sarcoma 3611 viral oncogene homolog, mRNA
NCBI Official Synonym Full Names
A-Raf proto-oncogene, serine/threonine kinase
NCBI Official Symbol
ARAF
NCBI Official Synonym Symbols
PKS2; A-RAF; ARAF1; RAFA1
NCBI Protein Information
serine/threonine-protein kinase A-Raf
UniProt Protein Name
Serine/threonine-protein kinase A-Raf
UniProt Gene Name
ARAF
UniProt Synonym Gene Names
ARAF1; PKS; PKS2
UniProt Entry Name
ARAF_HUMAN

NCBI Description

This proto-oncogene belongs to the RAF subfamily of the Ser/Thr protein kinase family, and maybe involved in cell growth and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2012]

Uniprot Description

ARAF: a tyrosine kinase-like kinase of the RAF family. Involved in the transduction of mitogenic signals from the cell membrane to the nucleus. May play a role in the postsynaptic responses of hippocampal neuron. Frequently mutated in thyroid cancers, skin melanomas and at lower frequency in a wide range of human cancers. An activating mutation, mimicking phosphorylation of the activation loop, is seen in 60% of malignant melanoma samples. Raf mutations are generally exclusive to Ras activating mutations. Activating mutations are also seen in ~10% of colorectal cancers, in lung cancers and gliomas, and at a lower rate in several other tumors. Inactivating mutations are also seen and may result in activation of c-Raf and Erk. Mutations in B-Raf, MEK1 and MEK2 also associated with cardiofaciocutaneous syndrome, displaying morphological, cardiac and mental defects. Approved Inhibitor: Nexavar/Sorafenib.

Protein type: Kinase, protein; EC 2.7.11.1; Oncoprotein; Protein kinase, TKL; Protein kinase, Ser/Thr (non-receptor); TKL group; RAF family

Chromosomal Location of Human Ortholog: Xp11.4-p11.2

Cellular Component: cytosol

Molecular Function: protein binding; protein kinase activity; protein serine/threonine kinase activity

Biological Process: MAPKKK cascade; negative regulation of apoptosis; positive regulation of peptidyl-serine phosphorylation; protein modification process; regulation of proteasomal ubiquitin-dependent protein catabolic process; regulation of TOR signaling pathway

Research Articles on ARAF

Similar Products

Product Notes

The ARAF araf (Catalog #AAA1278352) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagccac cacggggccc ccctgccaat ggggccgagc catcccgggc agtgggcacc gtcaaagtat acctgcccaa caagcaacgc acggtggtga ctgtccggga tggcatgagt gtctacgact ctctagacaa ggccctgaag gtgcggggtc taaatcagga ctgctgtgtg gtctaccgac tcatcaaggg acgaaagacg gtcactgcct gggacacagc cattgctccc ctggatggcg aggagctcat tgtcgaggtc cttgaagatg tcccgctgac catgcacaat tttgtacgga agaccttctt cagcctggcg ttctgtgact tctgccttaa gtttctgttc catggcttcc gttgccaaac ctgtggctac aagttccacc agcattgttc ctccaaggtc cccacagtct gtgttgacat gagtaccaac cgccaacagc cctcaaggtt ctaccacagt gtccaggatt tgtccggagg ctccagacag catgaggctc cctcgaaccg ccccctgaat gagttgctaa ccccccaggg tcccagcccc cgcacccagc actgtgaccc ggagcacttc cccttccctg ccccagccaa tgccccccta cagcgcatcc gctccacgtc cactcccaac gtccatatgg tcagcaccac ggcccccatg gactccaacc tcatccagct cactggccag agtttcagca ctgatgctgc cggtagtaga ggaggtagtg atggaacccc ccgggggagc cccagcccag ccagcgtgtc ctcggggagg aagtccccac attccaagtc accagcagag cagcgcgagc ggaagtcctt ggccgatgac aagaagaaag tgaagaacct ggggtaccgg gactcaggct attactggga ggtaccaccc agtgaggtgc agctgctgaa gaggatcggg acgggctcgt ttggcaccgt gtttcgaggg cggtggcatg gcgatgtggc cgtgaaggtg ctcaaggtgt cccagcccac agctgagcag gcccaggctt tcaagaatga gatgcaggtg ctcaggaaga cgcgacatgt caacatcttg ctgtttatgg gcttcatgac ccggccggga tttgccatca tcacacagtg gtgtgagggc tccagcctct accatcacct gcatgtggcc gacacacgct tcgacatggt ccagctcatc gacgtggccc ggcagactgc ccagggcatg gactacctcc atgccaagaa catcatccac cgagatctca agtctaacaa catcttccta catgaggggc tcacggtgaa gatcggtgac tttggcttgg ccacagtgaa gactcgatgg agcggggccc agcccttgga gcagccctca ggatctgtgc tgtggatggc agctgaggtg atccgtatgc aggacccgaa cccctacagc ttccagtcag acgtctatgc ctacggggtt gtgctctacg agcttatgac tggctcactg ccttacagcc acattggctg ccgtgaccag attatcttta tggtgggccg tggctatctg tccccggacc tcagcaaaat ctccagcaac tgccccaagg ccatgcggcg cctgctgtct gactgcctca agttccagcg ggaggagcgg cccctcttcc cccagatcct ggccacaatt gagctgctgc aacggtcact ccccaagatt gagcggagtg cctcggaacc ctccttgcac cgcacccagg ccgatgagtt gcctgcctgc ctactcagcg cagcccgcct tgtgccttag. It is sometimes possible for the material contained within the vial of "ARAF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.