Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APOC3 cdna clone

APOC3 cDNA Clone

Gene Names
APOC3; HALP2; APOCIII
Synonyms
APOC3; APOC3 cDNA Clone; APOC3 cdna clone
Ordering
For Research Use Only!
Sequence
ATGCAGCCCCGGGTACTCCTTGTTGTTGCCCTCCTGGCGCTCCTGGCCTCTGCCCGAGCTTCAGAGGCCGAGGATGCCTCCCTTCTCAGCTTCATGCAGGGCTACATGAAGCACGCCACCAAGACCGCCAAGGATGCACTGAGCAGCGTGCAGGAGTCCCAGGTGGCCCAGCAGGCCAGGGGCTGGGTGACCGATGGCTTCAGTTCCCTGAAAGACTACTGGAGCACCGTTAAGGACAAGTTCTCTGAGTTCTGGGATTTGGACCCTGAGGTCAGACCAACTTCAGCCGTGGCTGCCTGA
Sequence Length
300
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
345
Molecular Weight
10,852 Da
NCBI Official Full Name
Homo sapiens apolipoprotein C-III, mRNA
NCBI Official Synonym Full Names
apolipoprotein C3
NCBI Official Symbol
APOC3
NCBI Official Synonym Symbols
HALP2; APOCIII
NCBI Protein Information
apolipoprotein C-III
UniProt Protein Name
Apolipoprotein C-III
Protein Family
UniProt Gene Name
APOC3
UniProt Synonym Gene Names
Apo-CIII; ApoC-III
UniProt Entry Name
APOC3_HUMAN

NCBI Description

Apolipoprotein C-III is a very low density lipoprotein (VLDL) protein. APOC3 inhibits lipoprotein lipase and hepatic lipase; it is thought to delay catabolism of triglyceride-rich particles. The APOA1, APOC3 and APOA4 genes are closely linked in both rat and human genomes. The A-I and A-IV genes are transcribed from the same strand, while the A-1 and C-III genes are convergently transcribed. An increase in apoC-III levels induces the development of hypertriglyceridemia. [provided by RefSeq, Jul 2008]

Uniprot Description

APOC3: Inhibits lipoprotein lipase and hepatic lipase and decreases the uptake of lymph chylomicrons by hepatic cells. This suggests that it delays the catabolism of triglyceride-rich particles. Defects in APOC3 are the cause of hyperalphalipoproteinemia type 2 (HALP2). HALP2 is a condition characterized by high levels of high density lipoprotein (HDL) and increased HDL cholesterol levels. Belongs to the apolipoprotein C3 family.

Protein type: Secreted, signal peptide; Lipid-binding; Secreted

Chromosomal Location of Human Ortholog: 11q23.3

Cellular Component: chylomicron; early endosome; extracellular region; extracellular space

Molecular Function: cholesterol binding; enzyme regulator activity; lipase inhibitor activity; phospholipid binding

Biological Process: cholesterol efflux; cholesterol homeostasis; G-protein coupled receptor protein signaling pathway; lipoprotein metabolic process; negative regulation of fatty acid biosynthetic process; negative regulation of lipid catabolic process; negative regulation of lipid metabolic process; negative regulation of lipoprotein lipase activity; negative regulation of receptor-mediated endocytosis; phospholipid efflux; regulation of Cdc42 protein signal transduction; retinoid metabolic process; reverse cholesterol transport; triacylglycerol catabolic process; triacylglycerol metabolic process

Disease: Apolipoprotein C-iii Deficiency

Research Articles on APOC3

Similar Products

Product Notes

The APOC3 apoc3 (Catalog #AAA1270465) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCAGCCCC GGGTACTCCT TGTTGTTGCC CTCCTGGCGC TCCTGGCCTC TGCCCGAGCT TCAGAGGCCG AGGATGCCTC CCTTCTCAGC TTCATGCAGG GCTACATGAA GCACGCCACC AAGACCGCCA AGGATGCACT GAGCAGCGTG CAGGAGTCCC AGGTGGCCCA GCAGGCCAGG GGCTGGGTGA CCGATGGCTT CAGTTCCCTG AAAGACTACT GGAGCACCGT TAAGGACAAG TTCTCTGAGT TCTGGGATTT GGACCCTGAG GTCAGACCAA CTTCAGCCGT GGCTGCCTGA. It is sometimes possible for the material contained within the vial of "APOC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.