Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APOBEC3H cdna clone

APOBEC3H cDNA Clone

Gene Names
APOBEC3H; A3H; ARP10; ARP-10
Synonyms
APOBEC3H; APOBEC3H cDNA Clone; APOBEC3H cdna clone
Ordering
For Research Use Only!
Sequence
atggctctgttaacagccgaaacattccgcttacagtttaacaacaagcgccgcctcagaaggccttactacccgaggaaggccctcttgtgttaccagctgacgccgcagaatggctccacgcccacgagaggctactttgaaaacaagaaaaagtgccatgcagaaatttgctttattaacgagatcaagtccatgggactggacgaaacgcagtgctaccaagtcacctgttacctcacgtggagcccctgctcctcctgtgcctgggagctggttgacttcatcaaggctcacgaccatctgaacctgggcatcttcgcctcccgcctgtactaccactggtgcaagccccagcagaaggggctgcggcttctgtgtggatcccaggtcccggtggaggtcatgggcttcccagagtttgctgactgctgggaaaactttgtggaccacgagaaaccgctttccttcaacccctataagatgttagaggagctagataaaaacagtcgagccataaagcgacggcttgagaggataaagtcctga
Sequence Length
549
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,782 Da
NCBI Official Full Name
Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H, mRNA
NCBI Official Synonym Full Names
apolipoprotein B mRNA editing enzyme catalytic subunit 3H
NCBI Official Symbol
APOBEC3H
NCBI Official Synonym Symbols
A3H; ARP10; ARP-10
NCBI Protein Information
DNA dC->dU-editing enzyme APOBEC-3H
UniProt Protein Name
DNA dC->dU-editing enzyme APOBEC-3H
Protein Family
UniProt Gene Name
APOBEC3H
UniProt Synonym Gene Names
ARP-10; A3H
UniProt Entry Name
ABC3H_HUMAN

NCBI Description

This gene encodes a member of the apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3 family of proteins. The encoded protein is a cytidine deaminase that has antiretroviral activity by generating lethal hypermutations in viral genomes. Polymorphisms and alternative splicing in this gene influence its antiretroviral activity and are associated with increased resistence to human immunodeficiency virus type 1 infection in certain populations. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]

Uniprot Description

APOBEC3H: DNA cytidine deaminase which may provide cellular innate resistance to a specific panel of genetic invaders including endogenous retroelements and a subset of viruses. Belongs to the cytidine and deoxycytidylate deaminase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; EC 3.5.4.-

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: cytoplasm; nucleus

Molecular Function: cytidine deaminase activity; protein binding

Biological Process: defense response to virus; negative regulation of retroviral genome replication; negative regulation of viral reproduction

Research Articles on APOBEC3H

Similar Products

Product Notes

The APOBEC3H apobec3h (Catalog #AAA1278903) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctctgt taacagccga aacattccgc ttacagttta acaacaagcg ccgcctcaga aggccttact acccgaggaa ggccctcttg tgttaccagc tgacgccgca gaatggctcc acgcccacga gaggctactt tgaaaacaag aaaaagtgcc atgcagaaat ttgctttatt aacgagatca agtccatggg actggacgaa acgcagtgct accaagtcac ctgttacctc acgtggagcc cctgctcctc ctgtgcctgg gagctggttg acttcatcaa ggctcacgac catctgaacc tgggcatctt cgcctcccgc ctgtactacc actggtgcaa gccccagcag aaggggctgc ggcttctgtg tggatcccag gtcccggtgg aggtcatggg cttcccagag tttgctgact gctgggaaaa ctttgtggac cacgagaaac cgctttcctt caacccctat aagatgttag aggagctaga taaaaacagt cgagccataa agcgacggct tgagaggata aagtcctga. It is sometimes possible for the material contained within the vial of "APOBEC3H, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.