Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APOBEC3A cdna clone

APOBEC3A cDNA Clone

Gene Names
APOBEC3A; A3A; ARP3; PHRBN; bK150C2.1
Synonyms
APOBEC3A; APOBEC3A cDNA Clone; APOBEC3A cdna clone
Ordering
For Research Use Only!
Sequence
atggaagccagcccagcatccgggcccagacacttgatggatccacacatattcacttccaactttaacaatggcattggaaggcataagacctacctgtgctacgaagtggagcgcctggacaatggcacctcggtcaagatggaccagcacaggggctttctacacaaccaggctaagaatcttctctgtggcttttacggccgccatgcggagctgcgcttcttggacctggttccttctttgcagttggacccggcccagatctacagggtcacttggttcatctcctggagcccctgcttctcctggggctgtgccggggaagtgcgtgcgttccttcaggagaacacacacgtgagactgcgtatcttcgctgcccgcatctatgattacgaccccctatataaggaggcactgcaaatgctgcgggatgctggggcccaagtctccatcatgacctacgatgaatttaagcactgctgggacacctttgtggaccaccagggatgtcccttccagccctgggatggactagatgagcacagccaagccctgagtgggaggctgcgggccattctccagaatcagggaaactga
Sequence Length
600
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,778 Da
NCBI Official Full Name
Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A, mRNA
NCBI Official Synonym Full Names
apolipoprotein B mRNA editing enzyme catalytic subunit 3A
NCBI Official Symbol
APOBEC3A
NCBI Official Synonym Symbols
A3A; ARP3; PHRBN; bK150C2.1
NCBI Protein Information
DNA dC->dU-editing enzyme APOBEC-3A
UniProt Protein Name
DNA dC->dU-editing enzyme APOBEC-3A
Protein Family
UniProt Gene Name
APOBEC3A
UniProt Synonym Gene Names
A3A
UniProt Entry Name
ABC3A_HUMAN

NCBI Description

This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. The protein encoded by this gene lacks the zinc binding activity of other family members. The protein plays a role in immunity, by restricting transmission of foreign DNA such as viruses. One mechanism of foreign DNA restriction is deamination of foreign double-stranded DNA cytidines to uridines, which leads to DNA degradation. However, other mechanisms are also thought to be involved, as anti-viral effect is not dependent on deaminase activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]

Uniprot Description

APOBEC3A: a single-stranded DNA cytidine deaminase involved in foreign DNA clearance with restriction activity against viruses, foreign DNA and mobility of retrotransposons. Exhibits antiviral activity against adeno-associated virus (AAV) and human T-cell leukemia virus type 1 (HTLV-1) and may inhibit the mobility of LTR and non-LTR retrotransposons. Selectively targets single-stranded DNA and can deaminate both methylcytosine and cytosine in foreign DNA. Can induce somatic C-to-U hypermutation in nuclear and mitochondrial DNA. May also play a role in the epigenetic regulation of gene expression through the process of active DNA demethylation. Interacts with AGO2. Interacts with TRIB3. Expressed in peripheral leukocytes with higher expression in CD14-positive phagocytic cells. Highly expressed in keratinocytes and in periphery blood monocytes. Also detected in non-lymphoid tissues including lung and adipose tissues. Found at high levels in colorectal adenocarcinoma, Burkitt's lymphoma and chronic myelogenous leukemia. Up-regulated by interferon and CpG single-stranded DNA (at protein level). Belongs to the cytidine and deoxycytidylate deaminase family. 2 isoforms of the human protein are produced by alternative initiation.

Protein type: EC 3.5.4.-; Hydrolase

Chromosomal Location of Human Ortholog: 22q13.1-q13.2

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: cytidine deaminase activity; deoxycytidine deaminase activity; protein binding

Biological Process: defense response to virus; innate immune response; negative regulation of viral genome replication

Research Articles on APOBEC3A

Similar Products

Product Notes

The APOBEC3A apobec3a (Catalog #AAA1267800) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagcca gcccagcatc cgggcccaga cacttgatgg atccacacat attcacttcc aactttaaca atggcattgg aaggcataag acctacctgt gctacgaagt ggagcgcctg gacaatggca cctcggtcaa gatggaccag cacaggggct ttctacacaa ccaggctaag aatcttctct gtggctttta cggccgccat gcggagctgc gcttcttgga cctggttcct tctttgcagt tggacccggc ccagatctac agggtcactt ggttcatctc ctggagcccc tgcttctcct ggggctgtgc cggggaagtg cgtgcgttcc ttcaggagaa cacacacgtg agactgcgta tcttcgctgc ccgcatctat gattacgacc ccctatataa ggaggcactg caaatgctgc gggatgctgg ggcccaagtc tccatcatga cctacgatga atttaagcac tgctgggaca cctttgtgga ccaccaggga tgtcccttcc agccctggga tggactagat gagcacagcc aagccctgag tgggaggctg cgggccattc tccagaatca gggaaactga. It is sometimes possible for the material contained within the vial of "APOBEC3A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.