Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APOA2 cdna clone

APOA2 cDNA Clone

Gene Names
APOA2; apoAII; Apo-AII; ApoA-II
Synonyms
APOA2; APOA2 cDNA Clone; APOA2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagctgctcgcagcaactgtgctactcctcaccatctgcagccttgaaggagctttggttcggagacaggcaaaggagccatgtgtggagagcctggtttctcagtacttccagaccgtgactgactatggcaaggacctgatggagaaggtcaagagcccagagcttcaggccgaggccaagtcttactttgaaaagtcaaaggagcagctgacacccctgatcaagaaggctggaacggaactggttaacttcttgagctatttcgtggaacttggaacacagcctgccacccagtga
Sequence Length
303
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
336
Molecular Weight
11,175 Da
NCBI Official Full Name
Homo sapiens apolipoprotein A-II, mRNA
NCBI Official Synonym Full Names
apolipoprotein A2
NCBI Official Symbol
APOA2
NCBI Official Synonym Symbols
apoAII; Apo-AII; ApoA-II
NCBI Protein Information
apolipoprotein A-II
UniProt Protein Name
Apolipoprotein A-II
Protein Family
UniProt Gene Name
APOA2
UniProt Synonym Gene Names
Apo-AII; ApoA-II; ProapoA-II
UniProt Entry Name
APOA2_HUMAN

NCBI Description

This gene encodes apolipoprotein (apo-) A-II, which is the second most abundant protein of the high density lipoprotein particles. The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result in apolipoprotein A-II deficiency or hypercholesterolemia. [provided by RefSeq, Jul 2008]

Uniprot Description

APOA2: May stabilize HDL (high density lipoprotein) structure by its association with lipids, and affect the HDL metabolism. Belongs to the apolipoprotein A2 family.

Protein type: Endoplasmic reticulum; Lipid-binding; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 1q23.3

Cellular Component: chylomicron; cytosol; early endosome; endoplasmic reticulum lumen; extracellular region

Molecular Function: apolipoprotein receptor binding; cholesterol binding; cholesterol transporter activity; high-density lipoprotein binding; lipase inhibitor activity; lipid binding; lipid transporter activity; phosphatidylcholine binding; phospholipid binding; protein binding; protein heterodimerization activity; protein homodimerization activity

Biological Process: cholesterol efflux; cholesterol homeostasis; cholesterol metabolic process; diacylglycerol catabolic process; lipoprotein biosynthetic process; lipoprotein metabolic process; negative regulation of cholesterol transport; negative regulation of cytokine secretion during immune response; negative regulation of lipase activity; negative regulation of lipid catabolic process; peptidyl-methionine modification; phosphatidylcholine biosynthetic process; phospholipid catabolic process; phospholipid efflux; positive regulation of interleukin-8 biosynthetic process; positive regulation of lipid catabolic process; protein amino acid oxidation; regulation of protein stability; response to glucose stimulus; retinoid metabolic process; reverse cholesterol transport; triacylglycerol metabolic process

Disease: Hypercholesterolemia, Familial

Research Articles on APOA2

Similar Products

Product Notes

The APOA2 apoa2 (Catalog #AAA1273697) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagctgc tcgcagcaac tgtgctactc ctcaccatct gcagccttga aggagctttg gttcggagac aggcaaagga gccatgtgtg gagagcctgg tttctcagta cttccagacc gtgactgact atggcaagga cctgatggag aaggtcaaga gcccagagct tcaggccgag gccaagtctt actttgaaaa gtcaaaggag cagctgacac ccctgatcaa gaaggctgga acggaactgg ttaacttctt gagctatttc gtggaacttg gaacacagcc tgccacccag tga. It is sometimes possible for the material contained within the vial of "APOA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.