Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APITD1 cdna clone

APITD1 cDNA Clone

Gene Names
MHF1; CENPS; APITD1; CENP-S; FAAP16
Synonyms
APITD1; APITD1 cDNA Clone; APITD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggaggaggcggagaccgaggagcagcagcgattctcttaccaacagaggctaaaggcagcagttcactatactgtgggttgtctttgcgaggaagttgcattggacaaagagatgcagttcagcaaacagaccattgcggccatttcggagctgactttccgacagtgtgaaaattttgccaaagaccttgaaatgtttgcaagacatgcgaaaagaaccacaattaacactgaagatgtgaagctcttagccaggaggagtaattcactgctaaaatacatcacagacaaaagtgaagagattgctcagattaacctagaacgaaaagcacagaagaaaaagaagtcagaggatggaagcaaaaattcaaggcagccagcagaggctggagtggtggaaagtgagaattaa
Sequence Length
417
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,074 Da
NCBI Official Full Name
Homo sapiens apoptosis-inducing, TAF9-like domain 1, mRNA
NCBI Official Synonym Full Names
FANCM associated histone fold protein 1
NCBI Official Symbol
MHF1
NCBI Official Synonym Symbols
CENPS; APITD1; CENP-S; FAAP16
NCBI Protein Information
centromere protein S
UniProt Protein Name
Centromere protein S
Protein Family
UniProt Gene Name
APITD1
UniProt Synonym Gene Names
CENPS; FAAP16; MHF1; CENP-S
UniProt Entry Name
CENPS_HUMAN

NCBI Description

This gene was identified in the neuroblastoma tumor suppressor candidate region on chromosome 1p36. It contains a TFIID-31 domain, similar to that found in TATA box-binding protein-associated factor, TAF(II)31, which is required for p53-mediated transcription activation. This gene was expressed at very low levels in neuroblastoma tumors, and was shown to reduce cell growth in neuroblastoma cells, suggesting that it may have a role in a cell death pathway. The protein is a component of multiple complexes, including the Fanconi anemia (FA) core complex, the APITD1/CENPS complex, and the CENPA-CAD (nucleosome distal) complex. Known functions include an involvement with chromatin associations of the FA core complex, and a role in the stable assembly of the outer kinetochore. Alternative splicing of this gene results in multiple transcript variants. Naturally occurring read-through transcripts also exist between this gene and the downstream cortistatin (CORT) gene, as represented in GeneID:100526739. An APITD1-related pseudogene has been identified on chromosome 7. [provided by RefSeq, Nov 2010]

Uniprot Description

APITD1: DNA-binding component of the FA core complex involved in DNA damage repair and genome maintenance. Required for optimal chromatin association of the FA core complex. Required for efficient damage-induced monoubiquitination and focus formation of FANCD2. Stabilizes FAAD24, FANCM and STRA13/CENPX in the FA core complex. Plays a role in DNA interstrand cross-linking (ICL) repair and in recovery of replication forks stalled by topoisomerase I-DNA cleavage intermediates induced by camptothecin. Component of the heterotetrameric CENP-T-W-S-X complex that binds and supercoils DNA, and plays an important role in kinetochore assembly. Component of the APITD1/CENPS complex that is essential for the stable assembly of the outer kinetochore. Plays an important role in mitotic progression and chromosome segregation. Component of the CENPA-CAD (nucleosome distal) complex, a complex recruited to centromeres which is involved in assembly of kinetochore proteins, mitotic progression and chromosome segregation. Belongs to the TAF9 family. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 1p36.22

Cellular Component: cytosol; nucleoplasm

Molecular Function: chromatin binding; DNA binding; double-stranded DNA binding; protein binding

Biological Process: DNA repair; DNA replication-independent nucleosome assembly at centromere; mitotic recombination; positive regulation of protein ubiquitination; replication fork processing; resolution of meiotic joint molecules as recombinants; response to DNA damage stimulus; sister chromatid cohesion

Research Articles on APITD1

Similar Products

Product Notes

The APITD1 apitd1 (Catalog #AAA1271601) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagg aggcggagac cgaggagcag cagcgattct cttaccaaca gaggctaaag gcagcagttc actatactgt gggttgtctt tgcgaggaag ttgcattgga caaagagatg cagttcagca aacagaccat tgcggccatt tcggagctga ctttccgaca gtgtgaaaat tttgccaaag accttgaaat gtttgcaaga catgcgaaaa gaaccacaat taacactgaa gatgtgaagc tcttagccag gaggagtaat tcactgctaa aatacatcac agacaaaagt gaagagattg ctcagattaa cctagaacga aaagcacaga agaaaaagaa gtcagaggat ggaagcaaaa attcaaggca gccagcagag gctggagtgg tggaaagtga gaattaa. It is sometimes possible for the material contained within the vial of "APITD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.