Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APH1A cdna clone

APH1A cDNA Clone

Gene Names
APH1A; APH-1; APH-1A; CGI-78; 6530402N02Rik
Synonyms
APH1A; APH1A cDNA Clone; APH1A cdna clone
Ordering
For Research Use Only!
Sequence
atgggggctgcggtgtttttcggctgcactttcgtcgcgttcggcccggccttcgcgcttttcttgatcactgtggctggggacccgcttcgcgttatcatcctggtcgcaggggcatttttctggctggtctccctgctcctggcctctgtggtctggttcatcttggtccatgtgaccgaccggtcagatgcccggctccagtacggcctcctgatttttggtgctgctgtctctgtccttctacaggaggtgttccgctttgcctactacaagctgcttaagaaggcagatgaggggttagcatcgctgagtgaggacggaagatcacccatctccatccgccagatggcctatgtttctggtctctccttcggtatcatcagtggtgtcttctctgttatcaatattttggctgatgcacttgggccaggtgtggttgggatccatggagactcaccctattacttcctgacttcagcctttctgacagcagccattatcctgctccataccttttggggagttgtgttctttgatgcctgtgagaggagacggtactgggctttgggcctggtggttgggagtcacctactgacatcgggactgacattcctgaacccctggtatgaggccagcctgctgcccatctatgcagtcactgtttccatggggctctgggccttcatcacagctggagggtccctccgaagtattcagcgcagcctcttgtgccgacggcaggaggacagtcgggtgatggtgtattctgccctgcgcatcccacccgaggactga
Sequence Length
798
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,977 Da
NCBI Official Full Name
Homo sapiens anterior pharynx defective 1 homolog A (C. elegans), mRNA
NCBI Official Synonym Full Names
aph-1 homolog A, gamma-secretase subunit
NCBI Official Symbol
APH1A
NCBI Official Synonym Symbols
APH-1; APH-1A; CGI-78; 6530402N02Rik
NCBI Protein Information
gamma-secretase subunit APH-1A
UniProt Protein Name
Gamma-secretase subunit APH-1A
Protein Family
UniProt Gene Name
APH1A
UniProt Synonym Gene Names
PSF; APH-1a
UniProt Entry Name
APH1A_HUMAN

NCBI Description

This gene encodes a component of the gamma secretase complex that cleaves integral membrane proteins such as Notch receptors and beta-amyloid precursor protein. The gamma secretase complex contains this gene product, or the paralogous anterior pharynx defective 1 homolog B (APH1B), along with the presenilin, nicastrin, and presenilin enhancer-2 proteins. The precise function of this seven-transmembrane-domain protein is unknown though it is suspected of facilitating the association of nicastrin and presenilin in the gamma secretase complex as well as interacting with substrates of the gamma secretase complex prior to their proteolytic processing. Polymorphisms in a promoter region of this gene have been associated with an increased risk for developing sporadic Alzheimer's disease. Alternative splicing results in multiple protein-coding and non-protein-coding transcript variants. [provided by RefSeq, Aug 2011]

Uniprot Description

APH1A: Essential subunit of the gamma-secretase complex, an endoprotease complex that catalyzes the intramembrane cleavage of integral proteins such as Notch receptors and APP (beta-amyloid precursor protein). It probably represents a stabilizing cofactor for the presenilin homodimer that promotes the formation of a stable complex. Belongs to the APH-1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Endoplasmic reticulum; Apoptosis; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1p36.13-q31.3

Cellular Component: endoplasmic reticulum; Golgi apparatus; integral to plasma membrane; membrane; plasma membrane

Molecular Function: protein binding

Biological Process: amyloid precursor protein catabolic process; ephrin receptor signaling pathway; membrane protein ectodomain proteolysis; membrane protein intracellular domain proteolysis; Notch receptor processing; Notch signaling pathway; positive regulation of apoptosis; positive regulation of catalytic activity; protein processing

Research Articles on APH1A

Similar Products

Product Notes

The APH1A aph1a (Catalog #AAA1267378) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggctg cggtgttttt cggctgcact ttcgtcgcgt tcggcccggc cttcgcgctt ttcttgatca ctgtggctgg ggacccgctt cgcgttatca tcctggtcgc aggggcattt ttctggctgg tctccctgct cctggcctct gtggtctggt tcatcttggt ccatgtgacc gaccggtcag atgcccggct ccagtacggc ctcctgattt ttggtgctgc tgtctctgtc cttctacagg aggtgttccg ctttgcctac tacaagctgc ttaagaaggc agatgagggg ttagcatcgc tgagtgagga cggaagatca cccatctcca tccgccagat ggcctatgtt tctggtctct ccttcggtat catcagtggt gtcttctctg ttatcaatat tttggctgat gcacttgggc caggtgtggt tgggatccat ggagactcac cctattactt cctgacttca gcctttctga cagcagccat tatcctgctc catacctttt ggggagttgt gttctttgat gcctgtgaga ggagacggta ctgggctttg ggcctggtgg ttgggagtca cctactgaca tcgggactga cattcctgaa cccctggtat gaggccagcc tgctgcccat ctatgcagtc actgtttcca tggggctctg ggccttcatc acagctggag ggtccctccg aagtattcag cgcagcctct tgtgccgacg gcaggaggac agtcgggtga tggtgtattc tgccctgcgc atcccacccg aggactga. It is sometimes possible for the material contained within the vial of "APH1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.