Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AP1S2 cdna clone

AP1S2 cDNA Clone

Synonyms
AP1S2; AP1S2 cDNA Clone; AP1S2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagtttatgttgctttttagtcgtcagggaaagcttcgactgcaaaaatggtatgtcccactatcagacaaagagaagaaaaagatcacaagagaacttgttcagaccgttttagcacggaaacctaaaatgtgcagcttccttgagtggcgagatctgaagattgtttacaaaagatatgctagtctgtatttttgctgtgctattgaggatcaggacaatgaactaattaccctggaaataattcatcgttatgtggaattacttgacaagtatttcggcagtgtctgtgaactagatatcatctttaattttgagaaggcttattttattttggatgagtttcttttgggaggggaagttcaggaaacatccaagaaaaatgtccttaaagcaattgagcaggctgatctactgcaggaggaagctgaaaccccacgtagtgttcttgaagaaattggactgacataa
Sequence Length
474
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,225 Da
NCBI Official Full Name
Homo sapiens adaptor-related protein complex 1, sigma 2 subunit, mRNA
UniProt Protein Name
AP-1 complex subunit sigma-2
UniProt Gene Name
AP1S2
UniProt Entry Name
AP1S2_HUMAN

Uniprot Description

AP1S2: Subunit of clathrin-associated adaptor protein complex 1 that plays a role in protein sorting in the late-Golgi/trans-Golgi network (TGN) and/or endosomes. The AP complexes mediate both the recruitment of clathrin to membranes and the recognition of sorting signals within the cytosolic tails of transmembrane cargo molecules. Defects in AP1S2 are the cause of mental retardation X- linked type 59 (MRX59). It is characterized by significantly sub-average general intellectual functioning associated with impairments in adaptative behavior and manifested during the developmental period. In contrast to syndromic or specific X-linked mental retardation which also present with associated physical, neurological and/or psychiatric manifestations, intellectual deficiency is the only primary symptom of non-syndromic X-linked mental retardation. MRX59 consists of a mild-to-profound mental retardation. Other features includes hypotonia early in life and delay in walking. Belongs to the adaptor complexes small subunit family.

Chromosomal Location of Human Ortholog: Xp22.2

Cellular Component: AP-type membrane coat adaptor complex; cytoplasmic vesicle membrane; cytosol; Golgi apparatus; Golgi membrane; intracellular membrane-bound organelle; lysosomal membrane; trans-Golgi network membrane

Molecular Function: protein binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; regulation of defense response to virus by virus

Disease: Mental Retardation, X-linked, Syndromic 5

Similar Products

Product Notes

The AP1S2 ap1s2 (Catalog #AAA1269835) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagttta tgttgctttt tagtcgtcag ggaaagcttc gactgcaaaa atggtatgtc ccactatcag acaaagagaa gaaaaagatc acaagagaac ttgttcagac cgttttagca cggaaaccta aaatgtgcag cttccttgag tggcgagatc tgaagattgt ttacaaaaga tatgctagtc tgtatttttg ctgtgctatt gaggatcagg acaatgaact aattaccctg gaaataattc atcgttatgt ggaattactt gacaagtatt tcggcagtgt ctgtgaacta gatatcatct ttaattttga gaaggcttat tttattttgg atgagtttct tttgggaggg gaagttcagg aaacatccaa gaaaaatgtc cttaaagcaa ttgagcaggc tgatctactg caggaggaag ctgaaacccc acgtagtgtt cttgaagaaa ttggactgac ataa. It is sometimes possible for the material contained within the vial of "AP1S2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.