Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANGPTL3 cdna clone

ANGPTL3 cDNA Clone

Gene Names
ANGPTL3; ANL3; ANG-5; FHBL2; ANGPT5
Synonyms
ANGPTL3; ANGPTL3 cDNA Clone; ANGPTL3 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcacaattaagctccttctttttattgttcctctagttatttcctccagaattgatcaagacaattcatcatttgattctctatctccagagccaaaatcaagatttgctatgttagacgatgtaaaaattttagccaatggcctccttcagttgggacatggtcttaaagactttgtccataagacgaagggccaaattaatgacatatttcaaaaactcaacatatttgatcagtctttttatgatctatcgctgcaaaccagtgaaatcaaagaagaagaaaaggaactgagaagaactacatataaactacaagtcaaaaatgaagaggtaaagaatatgtcacttgaactcaactcaaaacttgaaagcctcctagaagaaaaaattctacttcaacaaaaagtgaaatatttagaagagcaactaactaacttaattcaaaatcaacctgaaactccagaacacccagaagtaacttcacttaaaacttttgtagaaaaacaagataatagcatcaaagaccttctccagaccgtggaagaccaatataaacaattaaaccaacagcatagtcaaataaaagaaatagaaaatcagctcagaaggactagtattcaagaacccacagaaatttctctatcttccaagccaagagcaccaagaactactccctttcttcagttgaatgaaataagaaatgtaaaacatgatggcattcctgctgaatgtaccaccatttataacagaggtgaacatacaagtggcatgtatgccatcagacccagcaactctcaagtttttcatgtctactgtgatgttatatcaggtagtccatggacattaattcaacatcgaatagatggatcacaaaacttcaatgaaacgtgggagaactacaaatatggttttgggaggcttgatggagaattttggttgggcctagagaagatatactccatagtgaagcaatctaattatgttttacgaattgagttggaagactggaaagacaacaaacattatattgaatattctttttacttgggaaatcacgaaaccaactatacgctacatctagttgcgattactggcaatgtccccaatgcaatcccggaaaacaaagatttggtgttttctacttgggatcacaaagcaaaaggacacttcaactgtccagagggttattcaggaggctggtggtggcatgatgagtgtggagaaaacaacctaaatggtaaatataacaaaccaagagcaaaatctaagccagagaggagaagaggattatcttggaagtctcaaaatggaaggttatactctataaaatcaaccaaaatgttgatccatccaacagattcagaaagctttgaatga
Sequence Length
1383
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,637 Da
NCBI Official Full Name
Homo sapiens angiopoietin-like 3, mRNA
NCBI Official Synonym Full Names
angiopoietin like 3
NCBI Official Symbol
ANGPTL3
NCBI Official Synonym Symbols
ANL3; ANG-5; FHBL2; ANGPT5
NCBI Protein Information
angiopoietin-related protein 3
UniProt Protein Name
Angiopoietin-related protein 3
UniProt Gene Name
ANGPTL3
UniProt Synonym Gene Names
ANGPT5; ANG-5
UniProt Entry Name
ANGL3_HUMAN

NCBI Description

This gene encodes a member of a family of secreted proteins that function in angiogenesis. The encoded protein, which is expressed predominantly in the liver, is further processed into an N-terminal coiled-coil domain-containing chain and a C-terminal fibrinogen chain. The N-terminal chain is important for lipid metabolism, while the C-terminal chain may be involved in angiogenesis. Mutations in this gene cause familial hypobetalipoproteinemia type 2. [provided by RefSeq, Aug 2015]

Uniprot Description

ANGPTL3: Defects in ANGPTL3 are the cause of familial hypobetalipoproteinemia type 2 (FHBL2); also called combined hypobetalipoproteinemia familial. FHBL2 is a disorder of lipid metabolism characterized by less than 5th percentile age- and sex-specific levels of low density lipoproteins, and dietary fat malabsorption. Affected individuals present with combined hypolipidemia, consisting of extremely low plasma levels of LDL cholesterol, HDL cholesterol, and triglycerides.

Protein type: Cell adhesion; Inhibitor; Secreted; Secreted, signal peptide; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 1p31.3

Cellular Component: cell surface; extracellular space

Molecular Function: enzyme inhibitor activity; growth factor activity; integrin binding; phospholipase inhibitor activity

Biological Process: acylglycerol homeostasis; artery morphogenesis; cell-matrix adhesion; cholesterol homeostasis; cholesterol metabolic process; fatty acid metabolic process; glycerol metabolic process; lipid homeostasis; negative regulation of lipoprotein lipase activity; phospholipid catabolic process; phospholipid homeostasis; phospholipid metabolic process; positive regulation of angiogenesis; positive regulation of cell migration; positive regulation of lipid catabolic process; sequestering of lipid; signal transduction

Disease: Hypobetalipoproteinemia, Familial, 2

Research Articles on ANGPTL3

Similar Products

Product Notes

The ANGPTL3 angptl3 (Catalog #AAA1272946) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcacaa ttaagctcct tctttttatt gttcctctag ttatttcctc cagaattgat caagacaatt catcatttga ttctctatct ccagagccaa aatcaagatt tgctatgtta gacgatgtaa aaattttagc caatggcctc cttcagttgg gacatggtct taaagacttt gtccataaga cgaagggcca aattaatgac atatttcaaa aactcaacat atttgatcag tctttttatg atctatcgct gcaaaccagt gaaatcaaag aagaagaaaa ggaactgaga agaactacat ataaactaca agtcaaaaat gaagaggtaa agaatatgtc acttgaactc aactcaaaac ttgaaagcct cctagaagaa aaaattctac ttcaacaaaa agtgaaatat ttagaagagc aactaactaa cttaattcaa aatcaacctg aaactccaga acacccagaa gtaacttcac ttaaaacttt tgtagaaaaa caagataata gcatcaaaga ccttctccag accgtggaag accaatataa acaattaaac caacagcata gtcaaataaa agaaatagaa aatcagctca gaaggactag tattcaagaa cccacagaaa tttctctatc ttccaagcca agagcaccaa gaactactcc ctttcttcag ttgaatgaaa taagaaatgt aaaacatgat ggcattcctg ctgaatgtac caccatttat aacagaggtg aacatacaag tggcatgtat gccatcagac ccagcaactc tcaagttttt catgtctact gtgatgttat atcaggtagt ccatggacat taattcaaca tcgaatagat ggatcacaaa acttcaatga aacgtgggag aactacaaat atggttttgg gaggcttgat ggagaatttt ggttgggcct agagaagata tactccatag tgaagcaatc taattatgtt ttacgaattg agttggaaga ctggaaagac aacaaacatt atattgaata ttctttttac ttgggaaatc acgaaaccaa ctatacgcta catctagttg cgattactgg caatgtcccc aatgcaatcc cggaaaacaa agatttggtg ttttctactt gggatcacaa agcaaaagga cacttcaact gtccagaggg ttattcagga ggctggtggt ggcatgatga gtgtggagaa aacaacctaa atggtaaata taacaaacca agagcaaaat ctaagccaga gaggagaaga ggattatctt ggaagtctca aaatggaagg ttatactcta taaaatcaac caaaatgttg atccatccaa cagattcaga aagctttgaa tga. It is sometimes possible for the material contained within the vial of "ANGPTL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.