Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AMFR cdna clone

AMFR cDNA Clone

Gene Names
AMFR; GP78; RNF45
Synonyms
AMFR; AMFR cDNA Clone; AMFR cdna clone
Ordering
For Research Use Only!
Sequence
atgccgctgctcttcctcgagcgcttcccctggcccagcctccgcacctacacgggcctcagcggcctggccctgctgggcaccatcatcagcgcctaccgcgcgctcagccagcccgaggccggccccggcgagccggaccagctaacggcctcgctgcagcctgagccgccggcgcccgcccggccgagcgccgggggaccccgggcccgcgatgtggcccagtacctgctctcagacagcctcttcgtgtgggttctagtaaataccgcttgctgtgttttgatgttggtggctaagctcatccagtgtattgtgtttggccctcttcgagtgagtgagagacagcatctcaaagacaaattttggaattttattttctacaagttcattttcatctttggtgtgctgaatgtccagacagtggaagaggtggtcatgtggtgcctctggtttgccggacttgtctttctgcacctgatggttcagctctgcaaggatcgatttgaatatctttccttctcgcccaccacgccgatgagcagccacggtcgagtcctgtccctgttggttgccatgctgctttcctgctgtggactggcggccgtctgctccatcaccggctacacccacggaatgcacaccttggctttcatggctgcagagtctcttcttgtgacagtgaggactgctcatgtgattttacgatacgtaattcacctctgggacctcaaccacgaagggacgtgggaaggaaaggggacgtatgtctattacacagactttgtcatggagctcactctcctgtccctggacctcatgcaccatattcacatgttgttatttggcaacatctggttatccatggccagcctggtcatctttatgcagctgcgttacctgtttcatgaggtgcaacgtcgaattcgtcggcacaagaactatctacgtgtggttggaaacatggaggccaggtttgcagttgcaactccagaggagctggctgtcaacaatgacgactgtgccatctgttgggactccatgcaggctgcgcggaaactgccctgtggacatcttttccacaactcctgtcttcgttcctggctagaacaagacacctcctgtccaacatgcagaatgtctcttaatattgccgacaataatcgtgtcagggaagaacatcaaggagagaacttggatgagaatttggttcctgtagcagcagccgaagggagacctcgcttaaaccaacacaatcacttcttccatttcgatgggtctcggattgcgagctggctgccgagtttttcggttgaagtgatgcacaccaccaacattcttggcattacgcaggccagcaactcccagctcaatgcaatggctcatcagattcaagagatgtttccccaggttccataccatctggtactgcaggacctccagctgacacgctcagttgaaataacaacagacaatattttagaaggacggattcaagtaccttttcctacacagcggtcagatagcatcagacctgcattgaacagtcctgtggaaaggccaagcagtgaccaggaagagggagaaacttctgctcagaccgagcgtgtgccactggacctcagtcctcgcctggaggagacgctggacttcggcgaggtggaagtggagcccagtgaggtggaagacttcgaggctcgtgggagccgcttctccaagtctgctgatgagagacagcgcatgctggtgcagcgtaaggacgaactcctccagcaagctcgcaaacgtttcttgaacaaaagttctgaagatgatgcggcctcagagagcttcctcccctcggaaggtgcgtcctctgaccccgtgaccctgcgtcgaaggatgctggctgccgccgcggaacggaggcttcagaagcagcagacctcctag
Sequence Length
1932
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
267
Molecular Weight
72,996 Da
NCBI Official Full Name
Homo sapiens autocrine motility factor receptor, mRNA
NCBI Official Synonym Full Names
autocrine motility factor receptor
NCBI Official Symbol
AMFR
NCBI Official Synonym Symbols
GP78; RNF45
NCBI Protein Information
E3 ubiquitin-protein ligase AMFR
UniProt Protein Name
E3 ubiquitin-protein ligase AMFR
UniProt Gene Name
AMFR
UniProt Synonym Gene Names
RNF45; AMF receptor
UniProt Entry Name
AMFR_HUMAN

NCBI Description

This locus encodes a glycosylated transmembrane receptor. Its ligand, autocrine motility factor, is a tumor motility-stimulating protein secreted by tumor cells. The encoded receptor is also a member of the E3 ubiquitin ligase family of proteins. It catalyzes ubiquitination and endoplasmic reticulum-associated degradation of specific proteins. [provided by RefSeq, Feb 2012]

Uniprot Description

AMFR: E3 ubiquitin-protein ligase that mediates the polyubiquitination of a number of proteins such as CD3D, CYP3A4, CFTR and APOB for proteasomal degradation. Component of a VCP/p97- AMFR/gp78 complex that participates in the final step of endoplasmic reticulum-associated degradation (ERAD). The VCP/p97- AMFR/gp78 complex is involved in the sterol-accelerated ERAD degradation of HMGCR through binding to the HMGCR-INSIG complex at the ER membrane and initiating ubiquitination of HMGCR. The ubiquitinated HMGCR is then released from the ER by the complex into the cytosol for subsequent destruction. Also acts as a scaffold protein to assemble a complex that couples ubiquitination, retranslocation and deglycosylation. Mediates tumor invasion and metastasis. Interacts with RNF5. Also forms an ERAD complex containing VCP/p97, NGLY1; PSMC1; SAKS1 AND RAD23B required for coupling retrotranslocation, ubiquitination and deglycosylation. Interacts with DRL1. Interacts (through a region distinct from the RING finger) with UBE2G2/UBC7. Component of the VCP/p97-AMFR/gp78 complex that enhances VCP/p97 binding to polyubiquitinated proteins for their degradation by the endoplasmic reticulum-associated degradation (ERAD) pathway. Interacts (via the VIM) with VCP/p97. Interacts (via its membrane domain) with INSIG1; the interaction initiates the sterol-mediated ubiquitination and degradation of HMGCR by the ERAD pathway. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.19; Motility/polarity/chemotaxis; Membrane protein, integral; Membrane protein, multi-pass; Ligase; Ubiquitin ligase; Ubiquitin conjugating system; Receptor, misc.; EC 6.3.2.-; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 16q21

Cellular Component: endoplasmic reticulum membrane; integral to endoplasmic reticulum membrane; membrane; perinuclear region of cytoplasm; protein complex

Molecular Function: chaperone binding; protein binding; protein binding, bridging; receptor activity; ubiquitin-protein ligase activity

Biological Process: cell motility; ER-associated protein catabolic process; positive regulation of protein binding; protein autoubiquitination; protein oligomerization; protein polyubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; signal transduction; ubiquitin-dependent protein catabolic process; unfolded protein response

Research Articles on AMFR

Similar Products

Product Notes

The AMFR amfr (Catalog #AAA1268893) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgctgc tcttcctcga gcgcttcccc tggcccagcc tccgcaccta cacgggcctc agcggcctgg ccctgctggg caccatcatc agcgcctacc gcgcgctcag ccagcccgag gccggccccg gcgagccgga ccagctaacg gcctcgctgc agcctgagcc gccggcgccc gcccggccga gcgccggggg accccgggcc cgcgatgtgg cccagtacct gctctcagac agcctcttcg tgtgggttct agtaaatacc gcttgctgtg ttttgatgtt ggtggctaag ctcatccagt gtattgtgtt tggccctctt cgagtgagtg agagacagca tctcaaagac aaattttgga attttatttt ctacaagttc attttcatct ttggtgtgct gaatgtccag acagtggaag aggtggtcat gtggtgcctc tggtttgccg gacttgtctt tctgcacctg atggttcagc tctgcaagga tcgatttgaa tatctttcct tctcgcccac cacgccgatg agcagccacg gtcgagtcct gtccctgttg gttgccatgc tgctttcctg ctgtggactg gcggccgtct gctccatcac cggctacacc cacggaatgc acaccttggc tttcatggct gcagagtctc ttcttgtgac agtgaggact gctcatgtga ttttacgata cgtaattcac ctctgggacc tcaaccacga agggacgtgg gaaggaaagg ggacgtatgt ctattacaca gactttgtca tggagctcac tctcctgtcc ctggacctca tgcaccatat tcacatgttg ttatttggca acatctggtt atccatggcc agcctggtca tctttatgca gctgcgttac ctgtttcatg aggtgcaacg tcgaattcgt cggcacaaga actatctacg tgtggttgga aacatggagg ccaggtttgc agttgcaact ccagaggagc tggctgtcaa caatgacgac tgtgccatct gttgggactc catgcaggct gcgcggaaac tgccctgtgg acatcttttc cacaactcct gtcttcgttc ctggctagaa caagacacct cctgtccaac atgcagaatg tctcttaata ttgccgacaa taatcgtgtc agggaagaac atcaaggaga gaacttggat gagaatttgg ttcctgtagc agcagccgaa gggagacctc gcttaaacca acacaatcac ttcttccatt tcgatgggtc tcggattgcg agctggctgc cgagtttttc ggttgaagtg atgcacacca ccaacattct tggcattacg caggccagca actcccagct caatgcaatg gctcatcaga ttcaagagat gtttccccag gttccatacc atctggtact gcaggacctc cagctgacac gctcagttga aataacaaca gacaatattt tagaaggacg gattcaagta ccttttccta cacagcggtc agatagcatc agacctgcat tgaacagtcc tgtggaaagg ccaagcagtg accaggaaga gggagaaact tctgctcaga ccgagcgtgt gccactggac ctcagtcctc gcctggagga gacgctggac ttcggcgagg tggaagtgga gcccagtgag gtggaagact tcgaggctcg tgggagccgc ttctccaagt ctgctgatga gagacagcgc atgctggtgc agcgtaagga cgaactcctc cagcaagctc gcaaacgttt cttgaacaaa agttctgaag atgatgcggc ctcagagagc ttcctcccct cggaaggtgc gtcctctgac cccgtgaccc tgcgtcgaag gatgctggct gccgccgcgg aacggaggct tcagaagcag cagacctcct ag. It is sometimes possible for the material contained within the vial of "AMFR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.