Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALG13 cdna clone

ALG13 cDNA Clone

Gene Names
ALG13; CDG1S; EIEE36; MDS031; TDRD13; CXorf45; GLT28D1; YGL047W
Synonyms
ALG13; ALG13 cDNA Clone; ALG13 cdna clone
Ordering
For Research Use Only!
Sequence
atgactatggcttacggcaagggagaccccctcctcccacccaggctgcagcacagtatgcattatgggcacgatcctccaatgcactactcacagacagctggcaatgttatgtctaatgaacattttcatcctcagcatccatctccgagacaaggtcggggatatgggatgcccaggaattcatctcggtttataaacaggcacaacatgccgggccctaaagttgatttttacccaggcccaggtaaaaggtgctgccagagctatgataacttctcttatagatctcgttcatttagacgtagtcaccgccagatgagttgtgtgaataaggagtcccagtatggatttaccccagggaatggacagatgcccaggggcttggaagaaactattactttttatgaagttgaagaaggggatgagactgcttatccaactttacctaatcatggaggtccctctacaatggttcctgctacttcaggatactgtgttggaaggcggggacatagctcaggcaaacagactttgaatttagaggagggcaatggccagagtgaaaatgggcgatatcatgaagaatatctttatcgtgcagagccagactatgaaacttcaggtgtttatagcacaactgcatctacagcaaacttgtctcttcaggacagaaagtcatgttctatgtctcctcaggacacagttacctcatacaactacccccagaagatgatgggaaatattgcagcagttgcagcttcctgtgccaataatgttccagctccagtcttatctaacggtgcagcggctaatcaagctattagtaccacttcagtttcctcacagaatgctatacagcctctctttgtatctccacctacacacggcaggccagatacaaaagttttgcagtactatttcaatctaggattgcagtgctattaccacagctactggcactccatggtctatgtgccacagatgcagcagcagcttcatgtagagaattatccagtctatactgagccacctctggtagatcaaaccgttcctcaatgctacagtgaggtgaggagagaagatggcatacaggcggaagcatcagcaaatgatacttttccgaatgctgattcttcatctgtccctcatggagcagtctattatccagtaatgtcagatccctatgggcagccacctttgccaggttttgactcctgccttccggttgtgccagattattcctgtgttcccccctggcatccagttggtacagcatatggtggttcttctcaaattcatggtgctataaatcctgggccaattggctgtattgctccatctcccccagcttctcattatgtacctcagggtatgtaa
Sequence Length
1380
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
106,858 Da
NCBI Official Full Name
Homo sapiens asparagine-linked glycosylation 13 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
ALG13, UDP-N-acetylglucosaminyltransferase subunit
NCBI Official Symbol
ALG13
NCBI Official Synonym Symbols
CDG1S; EIEE36; MDS031; TDRD13; CXorf45; GLT28D1; YGL047W
NCBI Protein Information
putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13
UniProt Protein Name
Putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13
UniProt Gene Name
ALG13
UniProt Synonym Gene Names
CXorf45; GLT28D1
UniProt Entry Name
ALG13_HUMAN

NCBI Description

The protein encoded by this gene is a subunit of a bipartite UDP-N-acetylglucosamine transferase. It heterodimerizes with asparagine-linked glycosylation 14 homolog to form a functional UDP-GlcNAc glycosyltransferase that catalyzes the second sugar addition of the highly conserved oligosaccharide precursor in endoplasmic reticulum N-linked glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]

Uniprot Description

ALG13: Isoform 2 may be involved in protein N-glycosylation, second step of the dolichol-linked oligosaccharide pathway. Belongs to the glycosyltransferase 28 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.4.19.12; Transferase; Glycan Metabolism - N-glycan biosynthesis; EC 2.4.1.141

Chromosomal Location of Human Ortholog: Xq23

Cellular Component: endoplasmic reticulum membrane

Molecular Function: N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity

Biological Process: dolichol-linked oligosaccharide biosynthetic process

Disease: Congenital Disorder Of Glycosylation, Type Is

Research Articles on ALG13

Similar Products

Product Notes

The ALG13 alg13 (Catalog #AAA1277702) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactatgg cttacggcaa gggagacccc ctcctcccac ccaggctgca gcacagtatg cattatgggc acgatcctcc aatgcactac tcacagacag ctggcaatgt tatgtctaat gaacattttc atcctcagca tccatctccg agacaaggtc ggggatatgg gatgcccagg aattcatctc ggtttataaa caggcacaac atgccgggcc ctaaagttga tttttaccca ggcccaggta aaaggtgctg ccagagctat gataacttct cttatagatc tcgttcattt agacgtagtc accgccagat gagttgtgtg aataaggagt cccagtatgg atttacccca gggaatggac agatgcccag gggcttggaa gaaactatta ctttttatga agttgaagaa ggggatgaga ctgcttatcc aactttacct aatcatggag gtccctctac aatggttcct gctacttcag gatactgtgt tggaaggcgg ggacatagct caggcaaaca gactttgaat ttagaggagg gcaatggcca gagtgaaaat gggcgatatc atgaagaata tctttatcgt gcagagccag actatgaaac ttcaggtgtt tatagcacaa ctgcatctac agcaaacttg tctcttcagg acagaaagtc atgttctatg tctcctcagg acacagttac ctcatacaac tacccccaga agatgatggg aaatattgca gcagttgcag cttcctgtgc caataatgtt ccagctccag tcttatctaa cggtgcagcg gctaatcaag ctattagtac cacttcagtt tcctcacaga atgctataca gcctctcttt gtatctccac ctacacacgg caggccagat acaaaagttt tgcagtacta tttcaatcta ggattgcagt gctattacca cagctactgg cactccatgg tctatgtgcc acagatgcag cagcagcttc atgtagagaa ttatccagtc tatactgagc cacctctggt agatcaaacc gttcctcaat gctacagtga ggtgaggaga gaagatggca tacaggcgga agcatcagca aatgatactt ttccgaatgc tgattcttca tctgtccctc atggagcagt ctattatcca gtaatgtcag atccctatgg gcagccacct ttgccaggtt ttgactcctg ccttccggtt gtgccagatt attcctgtgt tcccccctgg catccagttg gtacagcata tggtggttct tctcaaattc atggtgctat aaatcctggg ccaattggct gtattgctcc atctccccca gcttctcatt atgtacctca gggtatgtaa. It is sometimes possible for the material contained within the vial of "ALG13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.