Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALDH3A2 cdna clone

ALDH3A2 cDNA Clone

Gene Names
ALDH3A2; SLS; FALDH; ALDH10
Synonyms
ALDH3A2; ALDH3A2 cDNA Clone; ALDH3A2 cdna clone
Ordering
For Research Use Only!
Sequence
atggagctcgaagtccggcgggtccgacaggcgttcctgtccggccggtcgcgacctctgcggtttcggctgcagcagctggaggccctgcggaggatggtgcaggagcgcgagaaggatatcctgacggccatcgccgccgacctgtgcaagagtgaattcaatgtgtacagtcaggaagtcattactgtccttggggaaattgattttatgcttgagaatcttcctgaatgggttactgctaaaccagttaagaagaacgtgctcaccatgctggatgaggcctatattcagccacagcctctgggagtggtgctgataatcggagcttggaattaccccttcgttctcaccattcagccactgataggagccatcgctgcaggaaatgctgtgattataaagccttctgaactgagtgaaaatacagccaagatcttggcaaagcttctccctcagtatttagaccaggatctctatattgttattaatggtggtgttgaggaaaccacggagctcctgaagcagcgatttgaccacattttctatacgggaaacactgcggttggcaaaattgtcatggaagctgctgccaagcatctgacccctgtgactcttgaactgggagggaaaagtccatgttatattgataaagattgtgacctggacattgtttgcagacgcataacctggggaaaatacatgaattgtggccaaacctgcattgcacccgactatattctctgtgaagcatccctccaaaatcaaattgtatggaagattaaggaaacagtgaaggaattttatggagaaaatataaaagagtctcctgattatgaaaggatcatcaatcttcgtcattttaagaggatactaagtttgcttgaaggacaaaagatagcttttggtggggagactgatgaggccacacgctacatagccccaacagtacttaccgatgttgatcctaaaaccaaggtgatgcaagaagaaatttttggaccaattcttccaatagtgcctgtgaaaaatgtagatgaggccataaatttcataaatgaacgtgaaaagcctctggctctttatgtattttcgcataaccataagctcatcaaacggatgattgatgagacatccagtggaggtgtcacaggcaatgacgtcattatgcacttcacgctcaactctttcccatttggaggagtgggttccagtgggatgggagcttatcacggaaaacatagttttgatactttttctcatcagcgtccctgtttattaaaaagtttaaagagagaaggtgctaacaaactcagatatcctcccaacagccagtcaaaggtggattggggaaaattttttctcttgaaacggttcaacaaagaaaaactcggtctcctgttgctcactttcctgggtattgtagccgctgtgcttgtcaagaaataccaagctgtgctgaggagaaaggccctgttgatttttctggtagttcacagactgcgttggtccagtaagcagagatga
Sequence Length
1527
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
224
Molecular Weight
57,669 Da
NCBI Official Full Name
Homo sapiens aldehyde dehydrogenase 3 family, member A2, mRNA
NCBI Official Synonym Full Names
aldehyde dehydrogenase 3 family member A2
NCBI Official Symbol
ALDH3A2
NCBI Official Synonym Symbols
SLS; FALDH; ALDH10
NCBI Protein Information
fatty aldehyde dehydrogenase
UniProt Protein Name
Fatty aldehyde dehydrogenase
UniProt Gene Name
ALDH3A2
UniProt Synonym Gene Names
ALDH10; FALDH
UniProt Entry Name
AL3A2_HUMAN

NCBI Description

Aldehyde dehydrogenase isozymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This gene product catalyzes the oxidation of long-chain aliphatic aldehydes to fatty acid. Mutations in the gene cause Sjogren-Larsson syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

ALDH3A2: Catalyzes the oxidation of long-chain aliphatic aldehydes to fatty acids. Active on a variety of saturated and unsaturated aliphatic aldehydes between 6 and 24 carbons in length. Responsible for conversion of the sphingosine 1-phosphate (S1P) degradation product hexadecenal to hexadecenoic acid. Defects in ALDH3A2 are the cause of Sjoegren-Larsson syndrome (SLS). SLS is an autosomal recessive neurocutaneous disorder characterized by a combination of severe mental retardation, spastic di- or tetraplegia and congenital ichthyosis (increased keratinization). Ichthyosis is usually evident at birth, neurologic symptoms appear in the first or second year of life. Most patients have an IQ of less than 60. Additional clinical features include glistening white spots on the retina, seizures, short stature and speech defects. Belongs to the aldehyde dehydrogenase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Amino Acid Metabolism - lysine degradation; Carbohydrate Metabolism - ascorbate and aldarate; Carbohydrate Metabolism - butanoate; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Mitochondrial; Secondary Metabolites Metabolism - limonene and pinene degradation; Other Amino Acids Metabolism - beta-alanine; Amino Acid Metabolism - histidine; Oxidoreductase; EC 1.2.1.3; Amino Acid Metabolism - valine, leucine and isoleucine degradation; Amino Acid Metabolism - arginine and proline; Lipid Metabolism - fatty acid; Carbohydrate Metabolism - propanoate; Carbohydrate Metabolism - pyruvate; Lipid Metabolism - glycerolipid; Membrane protein, integral; Amino Acid Metabolism - tryptophan

Chromosomal Location of Human Ortholog: 17p11.2

Cellular Component: endoplasmic reticulum membrane; intracellular membrane-bound organelle; peroxisomal membrane

Molecular Function: 3-chloroallyl aldehyde dehydrogenase activity; aldehyde dehydrogenase (NAD) activity; long-chain-alcohol oxidase activity

Biological Process: aldehyde metabolic process; central nervous system development; epidermis development; fatty acid alpha-oxidation; peripheral nervous system development; phytol metabolic process; sphingolipid biosynthetic process

Disease: Sjogren-larsson Syndrome

Research Articles on ALDH3A2

Similar Products

Product Notes

The ALDH3A2 aldh3a2 (Catalog #AAA1272839) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctcg aagtccggcg ggtccgacag gcgttcctgt ccggccggtc gcgacctctg cggtttcggc tgcagcagct ggaggccctg cggaggatgg tgcaggagcg cgagaaggat atcctgacgg ccatcgccgc cgacctgtgc aagagtgaat tcaatgtgta cagtcaggaa gtcattactg tccttgggga aattgatttt atgcttgaga atcttcctga atgggttact gctaaaccag ttaagaagaa cgtgctcacc atgctggatg aggcctatat tcagccacag cctctgggag tggtgctgat aatcggagct tggaattacc ccttcgttct caccattcag ccactgatag gagccatcgc tgcaggaaat gctgtgatta taaagccttc tgaactgagt gaaaatacag ccaagatctt ggcaaagctt ctccctcagt atttagacca ggatctctat attgttatta atggtggtgt tgaggaaacc acggagctcc tgaagcagcg atttgaccac attttctata cgggaaacac tgcggttggc aaaattgtca tggaagctgc tgccaagcat ctgacccctg tgactcttga actgggaggg aaaagtccat gttatattga taaagattgt gacctggaca ttgtttgcag acgcataacc tggggaaaat acatgaattg tggccaaacc tgcattgcac ccgactatat tctctgtgaa gcatccctcc aaaatcaaat tgtatggaag attaaggaaa cagtgaagga attttatgga gaaaatataa aagagtctcc tgattatgaa aggatcatca atcttcgtca ttttaagagg atactaagtt tgcttgaagg acaaaagata gcttttggtg gggagactga tgaggccaca cgctacatag ccccaacagt acttaccgat gttgatccta aaaccaaggt gatgcaagaa gaaatttttg gaccaattct tccaatagtg cctgtgaaaa atgtagatga ggccataaat ttcataaatg aacgtgaaaa gcctctggct ctttatgtat tttcgcataa ccataagctc atcaaacgga tgattgatga gacatccagt ggaggtgtca caggcaatga cgtcattatg cacttcacgc tcaactcttt cccatttgga ggagtgggtt ccagtgggat gggagcttat cacggaaaac atagttttga tactttttct catcagcgtc cctgtttatt aaaaagttta aagagagaag gtgctaacaa actcagatat cctcccaaca gccagtcaaa ggtggattgg ggaaaatttt ttctcttgaa acggttcaac aaagaaaaac tcggtctcct gttgctcact ttcctgggta ttgtagccgc tgtgcttgtc aagaaatacc aagctgtgct gaggagaaag gccctgttga tttttctggt agttcacaga ctgcgttggt ccagtaagca gagatga. It is sometimes possible for the material contained within the vial of "ALDH3A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.