Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AKT1S1 cdna clone

AKT1S1 cDNA Clone

Gene Names
AKT1S1; Lobe; PRAS40
Synonyms
AKT1S1; AKT1S1 cDNA Clone; AKT1S1 cdna clone
Ordering
For Research Use Only!
Sequence
atggatgaggacgccaccctccaggaccttccccccttctgtgagtcagaccccgagagtacagatgatggcagcctgagcgaggagacccccgccggcccccccacctgctcagtgcccccagcctcagccctacccacacagcagtacgccaagtccctgcctgtgtctgtgcccgtctggggcttcaaggagaagaggacagaggcgcggtcatcagatgaggagaatgggccgccctcttcgcccgacctggaccgcatcgcggcgagcatgcgcgcgctggtgctgcgagaggccgaggacacccaggtcttcggggacctgccacggccgcggcttaacaccagcgacttccagaagctgaagcggaaatattga
Sequence Length
381
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,262 Da
NCBI Official Full Name
Homo sapiens AKT1 substrate 1 (proline-rich), mRNA
NCBI Official Synonym Full Names
AKT1 substrate 1
NCBI Official Symbol
AKT1S1
NCBI Official Synonym Symbols
Lobe; PRAS40
NCBI Protein Information
proline-rich AKT1 substrate 1
UniProt Protein Name
Proline-rich AKT1 substrate 1
UniProt Gene Name
AKT1S1
UniProt Entry Name
AKTS1_HUMAN

NCBI Description

AKT1S1 is a proline-rich substrate of AKT (MIM 164730) that binds 14-3-3 protein (see YWHAH, MIM 113508) when phosphorylated (Kovacina et al., 2003 [PubMed 12524439]).[supplied by OMIM, Mar 2008]

Uniprot Description

Subunit of mTORC1, which regulates cell growth and survival in response to nutrient and hormonal signals. mTORC1 is activated in response to growth factors or amino acids. Growth factor-stimulated mTORC1 activation involves a AKT1-mediated phosphorylation of TSC1-TSC2, which leads to the activation of the RHEB GTPase that potently activates the protein kinase activity of mTORC1. Amino acid-signaling to mTORC1 requires its relocalization to the lysosomes mediated by the Ragulator complex and the Rag GTPases. Activated mTORC1 up-regulates protein synthesis by phosphorylating key regulators of mRNA translation and ribosome synthesis. mTORC1 phosphorylates EIF4EBP1 and releases it from inhibiting the elongation initiation factor 4E (eiF4E). mTORC1 phosphorylates and activates S6K1 at 'Thr-389', which then promotes protein synthesis by phosphorylating PDCD4 and targeting it for degradation. Within mTORC1, AKT1S1 negatively regulates mTOR activity in a manner that is dependent on its phosphorylation state and binding to 14-3-3 proteins. Inhibits RHEB-GTP-dependent mTORC1 activation. Substrate for AKT1 phosphorylation, but can also be activated by AKT1-independent mechanisms. May also play a role in nerve growth factor-mediated neuroprotection.

Research Articles on AKT1S1

Similar Products

Product Notes

The AKT1S1 akt1s1 (Catalog #AAA1278444) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgagg acgccaccct ccaggacctt ccccccttct gtgagtcaga ccccgagagt acagatgatg gcagcctgag cgaggagacc cccgccggcc cccccacctg ctcagtgccc ccagcctcag ccctacccac acagcagtac gccaagtccc tgcctgtgtc tgtgcccgtc tggggcttca aggagaagag gacagaggcg cggtcatcag atgaggagaa tgggccgccc tcttcgcccg acctggaccg catcgcggcg agcatgcgcg cgctggtgct gcgagaggcc gaggacaccc aggtcttcgg ggacctgcca cggccgcggc ttaacaccag cgacttccag aagctgaagc ggaaatattg a. It is sometimes possible for the material contained within the vial of "AKT1S1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.