AGFG2 cdna clone
AGFG2 cDNA Clone
Gene Names
AGFG2; HRBL; RABR
Synonyms
AGFG2; AGFG2 cDNA Clone; AGFG2 cdna clone
Sequence
atggtgatggcggcgaagaagggcccgggcccgggcggcggggtcagcgggggcaaggcggaggcggaggcggcctcggaggtgtggtgccgtcgggtgcgggagctgggtggctgcagccaggccgggaaccgccactgcttcgagtgcgcccagcgcggggtcacctacgtggatatcaccgtgggcagcttcgtgtgcaccacctgctccggcctcctgagagggctgaacccccctcatcgtgtcaagtcaatctccatgacaactttcactgagcctgaagtagtattcctgcaatcccgtggaaatgaggtttgccggaagatttggttgggtctgtttgatgctcggacatctttagtaccagattccagggatcctcagaaagtgaaggagtttctccaggaaaaatatgagaagaagagatggtatgtccccccagaccaagtcaaggggcccacttataccaaaggcagtgcctccacccctgtgcagggctccatcccagaagggaagccccttcggacacttctgggtgatcctgcaccgtctctctcagttgctgcctccacctcgagccagcccgtcagtcagtctcacgctcggacatcccaggcccggagcactcagccacctccccactcctctgtcaaaaaagccagtactgacctgctggctgacatcggtggagacccctttgctgcaccccagatggcaccagcttttgctgcattccctgcctttgggggccagacaccttcccaaggaggctttgccaactttgatgcctttagcagtggccccagctcttctgtgtttggaagcctccctccagctggtcaagcctcgttccaggcccagccaactcctgcagggagcagccaggggactccatttggtgccactcccctggcacccgccagtcagccaaacagcctcgcagacgtgggcagcttcctgggacccggggtgcccgctgcaggtgttcctagcagcctcttcgggatggctggccaggtccccccgctccagtctgtcacgacgggcggcggcggcggcagcagcacagggctggcctttggagccttcactaaccctttcacagctcccgccgcccagtccccgctgccttccaccaacccgttccagcccaatggcttggcgccagggcccggctttgggatgagcagtgctgggcctggcttcccccaggcagtgccacccactggggcctttgccagctccttcccagcaccgctgttccccccgcagaccccgcttgttcagcagcagaatggctcttccttcggggacttaggatcagccaagttggggcagaggccactgagccagccagctgggatctccaccaaccccttcatgactggaccctcatcaagcccattcgcctccaaacctccaaccaccaaccccttcttgtag
Sequence Length
1446
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
17,344 Da
NCBI Official Full Name
Homo sapiens ArfGAP with FG repeats 2, mRNA
NCBI Official Synonym Full Names
ArfGAP with FG repeats 2
NCBI Official Symbol
AGFG2
NCBI Official Synonym Symbols
HRBL; RABR
NCBI Protein Information
arf-GAP domain and FG repeat-containing protein 2
UniProt Protein Name
Arf-GAP domain and FG repeat-containing protein 2
Protein Family
UniProt Gene Name
AGFG2
UniProt Synonym Gene Names
HRBL; RABR; RAB-R
UniProt Entry Name
AGFG2_HUMAN
NCBI Description
This gene is a member of the HIV-1 Rev binding protein (HRB) family and encodes a protein with one Arf-GAP zinc finger domain, several phe-gly (FG) motifs, and four asn-pro-phe (NPF) motifs. This protein interacts with Eps15 homology (EH) domains and plays a role in the Rev export pathway, which mediates the nucleocytoplasmic transfer of proteins and RNAs. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Feb 2013]
Uniprot Description
HRBL: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 7q22.1
Cellular Component: membrane
Similar Products
Product Notes
The AGFG2 agfg2 (Catalog #AAA1268915) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgatgg cggcgaagaa gggcccgggc ccgggcggcg gggtcagcgg gggcaaggcg gaggcggagg cggcctcgga ggtgtggtgc cgtcgggtgc gggagctggg tggctgcagc caggccggga accgccactg cttcgagtgc gcccagcgcg gggtcaccta cgtggatatc accgtgggca gcttcgtgtg caccacctgc tccggcctcc tgagagggct gaacccccct catcgtgtca agtcaatctc catgacaact ttcactgagc ctgaagtagt attcctgcaa tcccgtggaa atgaggtttg ccggaagatt tggttgggtc tgtttgatgc tcggacatct ttagtaccag attccaggga tcctcagaaa gtgaaggagt ttctccagga aaaatatgag aagaagagat ggtatgtccc cccagaccaa gtcaaggggc ccacttatac caaaggcagt gcctccaccc ctgtgcaggg ctccatccca gaagggaagc cccttcggac acttctgggt gatcctgcac cgtctctctc agttgctgcc tccacctcga gccagcccgt cagtcagtct cacgctcgga catcccaggc ccggagcact cagccacctc cccactcctc tgtcaaaaaa gccagtactg acctgctggc tgacatcggt ggagacccct ttgctgcacc ccagatggca ccagcttttg ctgcattccc tgcctttggg ggccagacac cttcccaagg aggctttgcc aactttgatg cctttagcag tggccccagc tcttctgtgt ttggaagcct ccctccagct ggtcaagcct cgttccaggc ccagccaact cctgcaggga gcagccaggg gactccattt ggtgccactc ccctggcacc cgccagtcag ccaaacagcc tcgcagacgt gggcagcttc ctgggacccg gggtgcccgc tgcaggtgtt cctagcagcc tcttcgggat ggctggccag gtccccccgc tccagtctgt cacgacgggc ggcggcggcg gcagcagcac agggctggcc tttggagcct tcactaaccc tttcacagct cccgccgccc agtccccgct gccttccacc aacccgttcc agcccaatgg cttggcgcca gggcccggct ttgggatgag cagtgctggg cctggcttcc cccaggcagt gccacccact ggggcctttg ccagctcctt cccagcaccg ctgttccccc cgcagacccc gcttgttcag cagcagaatg gctcttcctt cggggactta ggatcagcca agttggggca gaggccactg agccagccag ctgggatctc caccaacccc ttcatgactg gaccctcatc aagcccattc gcctccaaac ctccaaccac caaccccttc ttgtag. It is sometimes possible for the material contained within the vial of "AGFG2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
