Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AFP cdna clone

AFP cDNA Clone

Gene Names
AFP; AFPD; FETA; HPAFP
Synonyms
AFP; AFP cDNA Clone; AFP cdna clone
Ordering
For Research Use Only!
Sequence
atgaagtgggtggaatcaatttttttaattttcctactaaattttactgaatccagaacactgcatagaaatgaatatggaatagcttccatattggattcttaccaatgtactgcagagataagtttagctgacctggctaccatattttttgcccagtttgttcaagaagccacttacaaggaagtaagcaaaatggtgaaagatgcattgactgcaattgagaaacccactggagatgaacagtcttcagggtgtttagaaaaccagctacctgcctttctggaagaactttgccatgagaaagaaattttggagaagtacggacattcagactgctgcagccaaagtgaagagggaagacataactgttttcttgcacacaaaaagcccactccagcatcgatcccacttttccaagttccagaacctgtcacaagctgtgaagcatatgaagaagacagggagacattcatgaacaaattcatttatgagatagcaagaaggcatcccttcctgtatgcacctacaattcttctttgggctgctcgctatgacaaaataattccatcttgctgcaaagctgaaaatgcagttgaatgcttccaaacaaaggcagcaacagttacaaaagaattaagagaaagcagcttgttaaatcaacatgcatgtgcagtaatgaaaaattttgggacccgaactttccaagccataactgttactaaactgagtcagaagtttaccaaagttaattttactgaaatccagaaactagtcctggatgtggcccatgtacatgagcactgttgcagaggagatgtgctggattgtctgcaggatggggaaaaaatcatgtcctacatatgttctcaacaagacactctgtcaaacaaaataacagaatgctgcaaactgaccacgctggaacgtggtcaatgtataattcatgcagaaaatgatgaaaaacctgaaggtctatctccaaatctaaacaggtttttaggagatagagattttaaccaattttcttcaggggaaaaaaatatcttcttggcaagttttgttcatgaatattcaagaagacatcctcagcttgctgtctcagtaattctaagagttgctaaaggataccaggagttattggagaagtgtttccagactgaaaaccctcttgaatgccaagataaaggagaagaagaattacagaaatacatccaggagagccaagcattggcaaagcgaagctgcggcctcttccagaaactaggagaatattacttacaaaatgcgtttctcgttgcttacacaaagaaagccccccagctgacctcgtcggagctgatggccatcaccagaaaaatggcagccacagcagccacttgttgccaactcagtgaggacaaactattggcctgtggcgagggagcggctgacattattatcggacacttatgtatcagacatgaaatgactccagtaaaccctggtgttggccagtgctgcacttcttcatatgccaacaggaggccatgcttcagcagcttggtggtggatgaaacatatgtccctcctgcattctctgatgacaagttcattttccataaggatctgtgccaagctcagggtgtagcgctgcaaacgatgaagcaagagtttctcattaaccttgtgaagcaaaagccacaaataacagaggaacaacttgaggctgtcattgcagatttctcaggcctgttggagaaatgctgccaaggccaggaacaggaagtctgctttgctgaagagggacaaaaactgatttcaaaaactcgtgctgctttgggagtttaa
Sequence Length
1830
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
174
Molecular Weight
68,678 Da
NCBI Official Full Name
Homo sapiens alpha-fetoprotein, mRNA
NCBI Official Synonym Full Names
alpha fetoprotein
NCBI Official Symbol
AFP
NCBI Official Synonym Symbols
AFPD; FETA; HPAFP
NCBI Protein Information
alpha-fetoprotein
UniProt Protein Name
Alpha-fetoprotein
Protein Family
AFP
UniProt Gene Name
AFP
UniProt Synonym Gene Names
HPAFP
UniProt Entry Name
FETA_HUMAN

NCBI Description

This gene encodes alpha-fetoprotein, a major plasma protein produced by the yolk sac and the liver during fetal life. Alpha-fetoprotein expression in adults is often associated with hepatoma or teratoma. However, hereditary persistance of alpha-fetoprotein may also be found in individuals with no obvious pathology. The protein is thought to be the fetal counterpart of serum albumin, and the alpha-fetoprotein and albumin genes are present in tandem in the same transcriptional orientation on chromosome 4. Alpha-fetoprotein is found in monomeric as well as dimeric and trimeric forms, and binds copper, nickel, fatty acids and bilirubin. The level of alpha-fetoprotein in amniotic fluid is used to measure renal loss of protein to screen for spina bifida and anencephaly. [provided by RefSeq, Jul 2008]

Uniprot Description

AFP: Binds copper, nickel, and fatty acids as well as, and bilirubin less well than, serum albumin. Only a small percentage (less than 2%) of the human AFP shows estrogen-binding properties. Dimeric and trimeric forms have been found in addition to the monomeric form. Plasma. Synthesized by the fetal liver and yolk sac. Belongs to the ALB/AFP/VDB family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 4q13.3

Cellular Component: cytoplasm

Molecular Function: protein binding

Disease: Alpha-fetoprotein Deficiency; Alpha-fetoprotein, Hereditary Persistence Of

Research Articles on AFP

Similar Products

Product Notes

The AFP afp (Catalog #AAA1268522) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagtggg tggaatcaat ttttttaatt ttcctactaa attttactga atccagaaca ctgcatagaa atgaatatgg aatagcttcc atattggatt cttaccaatg tactgcagag ataagtttag ctgacctggc taccatattt tttgcccagt ttgttcaaga agccacttac aaggaagtaa gcaaaatggt gaaagatgca ttgactgcaa ttgagaaacc cactggagat gaacagtctt cagggtgttt agaaaaccag ctacctgcct ttctggaaga actttgccat gagaaagaaa ttttggagaa gtacggacat tcagactgct gcagccaaag tgaagaggga agacataact gttttcttgc acacaaaaag cccactccag catcgatccc acttttccaa gttccagaac ctgtcacaag ctgtgaagca tatgaagaag acagggagac attcatgaac aaattcattt atgagatagc aagaaggcat cccttcctgt atgcacctac aattcttctt tgggctgctc gctatgacaa aataattcca tcttgctgca aagctgaaaa tgcagttgaa tgcttccaaa caaaggcagc aacagttaca aaagaattaa gagaaagcag cttgttaaat caacatgcat gtgcagtaat gaaaaatttt gggacccgaa ctttccaagc cataactgtt actaaactga gtcagaagtt taccaaagtt aattttactg aaatccagaa actagtcctg gatgtggccc atgtacatga gcactgttgc agaggagatg tgctggattg tctgcaggat ggggaaaaaa tcatgtccta catatgttct caacaagaca ctctgtcaaa caaaataaca gaatgctgca aactgaccac gctggaacgt ggtcaatgta taattcatgc agaaaatgat gaaaaacctg aaggtctatc tccaaatcta aacaggtttt taggagatag agattttaac caattttctt caggggaaaa aaatatcttc ttggcaagtt ttgttcatga atattcaaga agacatcctc agcttgctgt ctcagtaatt ctaagagttg ctaaaggata ccaggagtta ttggagaagt gtttccagac tgaaaaccct cttgaatgcc aagataaagg agaagaagaa ttacagaaat acatccagga gagccaagca ttggcaaagc gaagctgcgg cctcttccag aaactaggag aatattactt acaaaatgcg tttctcgttg cttacacaaa gaaagccccc cagctgacct cgtcggagct gatggccatc accagaaaaa tggcagccac agcagccact tgttgccaac tcagtgagga caaactattg gcctgtggcg agggagcggc tgacattatt atcggacact tatgtatcag acatgaaatg actccagtaa accctggtgt tggccagtgc tgcacttctt catatgccaa caggaggcca tgcttcagca gcttggtggt ggatgaaaca tatgtccctc ctgcattctc tgatgacaag ttcattttcc ataaggatct gtgccaagct cagggtgtag cgctgcaaac gatgaagcaa gagtttctca ttaaccttgt gaagcaaaag ccacaaataa cagaggaaca acttgaggct gtcattgcag atttctcagg cctgttggag aaatgctgcc aaggccagga acaggaagtc tgctttgctg aagagggaca aaaactgatt tcaaaaactc gtgctgcttt gggagtttaa. It is sometimes possible for the material contained within the vial of "AFP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.