Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AEN cdna clone

AEN cDNA Clone

Gene Names
AEN; ISG20L1; pp12744
Synonyms
AEN; AEN cDNA Clone; AEN cdna clone
Ordering
For Research Use Only!
Sequence
atggtgggcacgggaccccgagggcgggtaagcgagctggcccgctgttccattgtgagctaccatggcgatgtcctctatgacaagtacatcaggcctgagatgcccatcgctgactaccgtacccgctggagtggcatcactcggcagcacatgcgcaaggctgtccccttccaggtggcccagaaagagatccttaagctcctgaagggcaaggtggtggtggggcacgcgctgcacaacgacttccaggcgctcaagtatgtccaccctcggagccagacccgggataccacctatgtcccaaacttcctcagcgagcccggcctccacacccgggcccgggtctctctaaaggacctggccctgcagctgctgcacaagaagatccaggtgggccagcacgggcactcatcagtagaagatgccacgacagccatggagctctaccggctggtggaggtgcagtgggaacagcaggaggcccgcagcctctggacctgccccgaggacagagaacctgacagcagcacagacatggaacagtacatggaggaccagtactggcccgatgacctggcccacggcagcagaggaggagccagggaggcacaggacagaaggaattga
Sequence Length
630
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,496 Da
NCBI Official Full Name
Homo sapiens apoptosis enhancing nuclease, mRNA
NCBI Official Synonym Full Names
apoptosis enhancing nuclease
NCBI Official Symbol
AEN
NCBI Official Synonym Symbols
ISG20L1; pp12744
NCBI Protein Information
apoptosis-enhancing nuclease
UniProt Protein Name
Apoptosis-enhancing nuclease
UniProt Gene Name
AEN
UniProt Synonym Gene Names
ISG20L1
UniProt Entry Name
AEN_HUMAN

Uniprot Description

AEN: Exonuclease with activity against single- and double- stranded DNA and RNA. Mediates p53-induced apoptosis. When induced by p53 following DNA damage, digests double-stranded DNA to form single-stranded DNA and amplifies DNA damage signals, leading to enhancement of apoptosis. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleolus; EC 3.1.-.-; Apoptosis; Hydrolase

Chromosomal Location of Human Ortholog: 15q26.1

Cellular Component: nuclear membrane; nucleolus; nucleoplasm; nucleus

Molecular Function: exonuclease activity; protein binding

Biological Process: DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis; response to ionizing radiation

Research Articles on AEN

Similar Products

Product Notes

The AEN aen (Catalog #AAA1276512) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgggca cgggaccccg agggcgggta agcgagctgg cccgctgttc cattgtgagc taccatggcg atgtcctcta tgacaagtac atcaggcctg agatgcccat cgctgactac cgtacccgct ggagtggcat cactcggcag cacatgcgca aggctgtccc cttccaggtg gcccagaaag agatccttaa gctcctgaag ggcaaggtgg tggtggggca cgcgctgcac aacgacttcc aggcgctcaa gtatgtccac cctcggagcc agacccggga taccacctat gtcccaaact tcctcagcga gcccggcctc cacacccggg cccgggtctc tctaaaggac ctggccctgc agctgctgca caagaagatc caggtgggcc agcacgggca ctcatcagta gaagatgcca cgacagccat ggagctctac cggctggtgg aggtgcagtg ggaacagcag gaggcccgca gcctctggac ctgccccgag gacagagaac ctgacagcag cacagacatg gaacagtaca tggaggacca gtactggccc gatgacctgg cccacggcag cagaggagga gccagggagg cacaggacag aaggaattga. It is sometimes possible for the material contained within the vial of "AEN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.