Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADRM1 cdna clone

ADRM1 cDNA Clone

Gene Names
ADRM1; ARM1; ARM-1; GP110
Synonyms
ADRM1; ADRM1 cDNA Clone; ADRM1 cdna clone
Ordering
For Research Use Only!
Sequence
atgacgacctcaggcgcgctctttccaagcctggtgccaggctctcggggcgcctccaacaagtacttggtggagtttcgggcgggaaagatgtccctgaaggggaccaccgtgactccggataagcggaaagggctggtgtacattcagcagacggacgactcgcttattcacttctgctggaaggacaggacgtccgggaacgtggaagacgacttgatcatcttccctgacgactgtgagttcaagcgggtgccgcagtgccccagcgggagggtctacgtgctgaagttcaaggcagggtccaagcggcttttcttctggatgcaggaacccaagacagaccaggatgaggagcattgccggaaagtcaacgagtatctgaacaaccccccgatgcctggggcactgggggccagcggaagcagcggccacgaactctctgcgctaggcggtgagggtggcctgcagagcctgctgggaaacatgagccacagccagctcatgcagctcatcggaccagccggcctcggaggactgggtgggctgggggccctgactggacctggcctggccagtttactggggagcagtgggcctccagggagcagctcctcctccagctcccggagccagtcggcagcggtcaccccgtcatccaccacctcttccacccgtgccaccccagccccttctgctccagcagctgcctcagcaactagcccgagccccgcgcccagttccgggaatggagccagcacagcagccagcccgacccagcccatccagctgagcgacctccagagcatcctggccacgatgaacgtaccagccgggccagcaggcggccagcaagtggacctggccagtgtgctgacgccggagataatggctcccatcctcgccaacgcggatgtccaggagcgcctgcttccctacttgccatctggggagtcgctgccgcagaccgcggatgagatccagaataccctgacctcgccccagttccagcaggccctgggcatgttcagcgcagccttggcctcggggcagctgggccccctcatgtgccagttcggtctgcctgcagaggctgtggaggccgccaacaagggcgatgtggaagcgtttgccaaagccatgcagaacaacgccaagcccgagcagaaagagggcgacacgaaggacaagaaggacgaagaggaggacatgagcctggactga
Sequence Length
1224
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,153 Da
NCBI Official Full Name
Homo sapiens adhesion regulating molecule 1, mRNA
NCBI Official Synonym Full Names
adhesion regulating molecule 1
NCBI Official Symbol
ADRM1
NCBI Official Synonym Symbols
ARM1; ARM-1; GP110
NCBI Protein Information
proteasomal ubiquitin receptor ADRM1
UniProt Protein Name
Proteasomal ubiquitin receptor ADRM1
UniProt Gene Name
ADRM1
UniProt Synonym Gene Names
GP110; Gp110; ARM-1; hRpn13
UniProt Entry Name
ADRM1_HUMAN

NCBI Description

This gene encodes a member of the adhesion regulating molecule 1 protein family. The encoded protein is a component of the proteasome where it acts as a ubiquitin receptor and recruits the deubiquitinating enzyme, ubiquitin carboxyl-terminal hydrolase L5. Increased levels of the encoded protein are associated with increased cell adhesion, which is likely an indirect effect of this intracellular protein. Dysregulation of this gene has been implicated in carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Uniprot Description

ADRM1: Functions as a proteasomal ubiquitin receptor. Recruits the deubiquitinating enzyme UCHL5 at the 26S proteasome and promotes its activity. Interacts with PSMD1, ubiquitin and UCHL5. Belongs to the ADRM1 family.

Protein type: Proteasome complex; Cell development/differentiation

Chromosomal Location of Human Ortholog: 20q13.33

Cellular Component: cytoplasm; integral to plasma membrane; membrane; nucleoplasm; plasma membrane; proteasome complex

Molecular Function: protease binding; protein binding

Biological Process: proteasome assembly; RNA elongation from RNA polymerase II promoter

Research Articles on ADRM1

Similar Products

Product Notes

The ADRM1 adrm1 (Catalog #AAA1270382) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgacct caggcgcgct ctttccaagc ctggtgccag gctctcgggg cgcctccaac aagtacttgg tggagtttcg ggcgggaaag atgtccctga aggggaccac cgtgactccg gataagcgga aagggctggt gtacattcag cagacggacg actcgcttat tcacttctgc tggaaggaca ggacgtccgg gaacgtggaa gacgacttga tcatcttccc tgacgactgt gagttcaagc gggtgccgca gtgccccagc gggagggtct acgtgctgaa gttcaaggca gggtccaagc ggcttttctt ctggatgcag gaacccaaga cagaccagga tgaggagcat tgccggaaag tcaacgagta tctgaacaac cccccgatgc ctggggcact gggggccagc ggaagcagcg gccacgaact ctctgcgcta ggcggtgagg gtggcctgca gagcctgctg ggaaacatga gccacagcca gctcatgcag ctcatcggac cagccggcct cggaggactg ggtgggctgg gggccctgac tggacctggc ctggccagtt tactggggag cagtgggcct ccagggagca gctcctcctc cagctcccgg agccagtcgg cagcggtcac cccgtcatcc accacctctt ccacccgtgc caccccagcc ccttctgctc cagcagctgc ctcagcaact agcccgagcc ccgcgcccag ttccgggaat ggagccagca cagcagccag cccgacccag cccatccagc tgagcgacct ccagagcatc ctggccacga tgaacgtacc agccgggcca gcaggcggcc agcaagtgga cctggccagt gtgctgacgc cggagataat ggctcccatc ctcgccaacg cggatgtcca ggagcgcctg cttccctact tgccatctgg ggagtcgctg ccgcagaccg cggatgagat ccagaatacc ctgacctcgc cccagttcca gcaggccctg ggcatgttca gcgcagcctt ggcctcgggg cagctgggcc ccctcatgtg ccagttcggt ctgcctgcag aggctgtgga ggccgccaac aagggcgatg tggaagcgtt tgccaaagcc atgcagaaca acgccaagcc cgagcagaaa gagggcgaca cgaaggacaa gaaggacgaa gaggaggaca tgagcctgga ctga. It is sometimes possible for the material contained within the vial of "ADRM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.