Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADH1C cdna clone

ADH1C cDNA Clone

Gene Names
ADH1C; ADH3
Synonyms
ADH1C; ADH1C cDNA Clone; ADH1C cdna clone
Ordering
For Research Use Only!
Sequence
atgagcacagcaggaaaagtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtagaggttgcacctcctaaggctcatgaagttcgcattaagatggtggctgcaggaatctgtcgttcagatgagcatgtggttagtggcaacctggtgaccccccttcctgtgattttaggccatgaggcagccggcatcgtggaaagtgttggagaaggggtgactacagtcaaaccaggtgataaagtcatcccgctctttactcctcagtgtggaaaatgcagaatttgtaaaaacccagaaagcaactactgcttgaaaaatgatctaggcaatcctcgggggaccctgcaggatggcaccaggaggttcacctgcagcgggaagcccatccaccacttcgtcggcgtcagcaccttctcccagtacacggtggtggatgagaatgcagtggccaaaattgatgcagcctcgcccctggagaaagtctgcctcattggctgtggattttcgactggttatgggtctgcagtcaaagttgccaaggtcaccccagggtctacctgtgctgtgtttggcctgggaggggtcggcctatctgttgttatgggctgtaaagcagctggagcagccagaatcattgctgtggacatcaacaaggacaaatttgcaaaggctaaagagttgggtgccactgaatgcatcaaccctcaagactacaagaaacccattcaggaagtgctaaaggaaatgactgatggaggtgtggatttttcgtttgaagtcatcggtcggcttgacaccatgatggcttccctgttatgttgtcatgaggcatgtggcacaagtgtcattgtaggggtacctcctgattcccagaacctctcaataaaccctatgctgctactgactggacgcacgtggaaaggagctatttttggaggctttaagagtaaagaatctgtccccaaacttgtggctgactttatggctaagaagttttcactggatgcattaataacaaatattttaccttttgaaaaaataaatgaaggatttgacctgcttcgctctggaaagagtatccgtaccgtcctgacgttttga
Sequence Length
1128
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
126
Molecular Weight
39,868 Da
NCBI Official Full Name
Homo sapiens alcohol dehydrogenase 1C (class I), gamma polypeptide, mRNA
NCBI Official Synonym Full Names
alcohol dehydrogenase 1C (class I), gamma polypeptide
NCBI Official Symbol
ADH1C
NCBI Official Synonym Symbols
ADH3
NCBI Protein Information
alcohol dehydrogenase 1C
UniProt Protein Name
Alcohol dehydrogenase 1C
Protein Family
UniProt Gene Name
ADH1C
UniProt Synonym Gene Names
ADH3
UniProt Entry Name
ADH1G_HUMAN

NCBI Description

This gene encodes class I alcohol dehydrogenase, gamma subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class I alcohol dehydrogenase, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation and plays a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster. [provided by RefSeq, Jul 2008]

Uniprot Description

ADH1C: class I alcohol dehydrogenase, gamma subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class I alcohol dehydrogenase, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation and plays a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster. [provided by RefSeq, Jul 2008]

Protein type: EC 1.1.1.1; Xenobiotic Metabolism - drug metabolism - cytochrome P450; Lipid Metabolism - fatty acid; Amino Acid Metabolism - tyrosine; Oxidoreductase; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Xenobiotic Metabolism - metabolism by cytochrome P450; Cofactor and Vitamin Metabolism - retinol; Mitochondrial

Chromosomal Location of Human Ortholog: 4q23

Cellular Component: cytosol

Molecular Function: alcohol dehydrogenase activity; alcohol dehydrogenase activity, zinc-dependent; retinol dehydrogenase activity

Biological Process: ethanol oxidation

Disease: Alcohol Dependence; Parkinson Disease, Late-onset

Research Articles on ADH1C

Similar Products

Product Notes

The ADH1C adh1c (Catalog #AAA1273356) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcacag caggaaaagt aatcaaatgc aaagcagctg tgctatggga gttaaagaaa cccttttcca ttgaggaggt agaggttgca cctcctaagg ctcatgaagt tcgcattaag atggtggctg caggaatctg tcgttcagat gagcatgtgg ttagtggcaa cctggtgacc ccccttcctg tgattttagg ccatgaggca gccggcatcg tggaaagtgt tggagaaggg gtgactacag tcaaaccagg tgataaagtc atcccgctct ttactcctca gtgtggaaaa tgcagaattt gtaaaaaccc agaaagcaac tactgcttga aaaatgatct aggcaatcct cgggggaccc tgcaggatgg caccaggagg ttcacctgca gcgggaagcc catccaccac ttcgtcggcg tcagcacctt ctcccagtac acggtggtgg atgagaatgc agtggccaaa attgatgcag cctcgcccct ggagaaagtc tgcctcattg gctgtggatt ttcgactggt tatgggtctg cagtcaaagt tgccaaggtc accccagggt ctacctgtgc tgtgtttggc ctgggagggg tcggcctatc tgttgttatg ggctgtaaag cagctggagc agccagaatc attgctgtgg acatcaacaa ggacaaattt gcaaaggcta aagagttggg tgccactgaa tgcatcaacc ctcaagacta caagaaaccc attcaggaag tgctaaagga aatgactgat ggaggtgtgg atttttcgtt tgaagtcatc ggtcggcttg acaccatgat ggcttccctg ttatgttgtc atgaggcatg tggcacaagt gtcattgtag gggtacctcc tgattcccag aacctctcaa taaaccctat gctgctactg actggacgca cgtggaaagg agctattttt ggaggcttta agagtaaaga atctgtcccc aaacttgtgg ctgactttat ggctaagaag ttttcactgg atgcattaat aacaaatatt ttaccttttg aaaaaataaa tgaaggattt gacctgcttc gctctggaaa gagtatccgt accgtcctga cgttttga. It is sometimes possible for the material contained within the vial of "ADH1C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.