ACY3 cdna clone
ACY3 cDNA Clone
Gene Names
ACY3; ACY-3; HCBP1
Synonyms
ACY3; ACY3 cDNA Clone; ACY3 cdna clone
Sequence
atgtgctcactgcctgtgccccgggagcccctgcgtcgcgtggctgtgactgggggcacgcatggcaacgagatgtcgggcgtctacctggcccggcactggctgcatgcccccgcagagctgcagagagccagcttctccgctgtgcctgtgctggccaacccggcagccacatccggctgccgccgctacgtggaccatgacctcaaccgcaccttcaccagcagcttcctcaattccaggcccaccccggacgacccatatgaggtgacaagagcccgagagctgaaccagctgctggggcccaaggcctcgggccaggcctttgactttgtccttgacctgcacaacaccacggccaacatgggcacctgcttaatcgcgaagtcctcccacgaagtctttgccatgcacctgtgccgccatctgcagctgcagtaccccgagctgtcctgccaggtcttcctgtaccagcggtctggggaggagagctacaacctggactctgtggccaaaaatggactgggtctggagctgggcccccagccacagggtgtgctgcgggctgacattttctcaaggatgaggaccctggtggccacagttctggacttcatcgaactcttcaaccagggtacggcctttcctgcctttgagatggaagcctatagacccgtgggcgtcgtggacttcccccgcaccgaggccgggcacctggcaggcactgtgcatcctcagctgcaggaccgagacttccagccactgcagcctggtgctcccatcttccagatgttcagtggggaggacctgctctatgagggagagtccacggtgtaccccgtgttcattaacgaggctgcctactatgagaagggcgttgcctttgtccagactgagaagttcacattcaccgtgcctgccatgcccgcgctgacccctgccccgagcccagcttcctaa
Sequence Length
960
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
35,241 Da
NCBI Official Full Name
Homo sapiens aspartoacylase (aminocyclase) 3, mRNA
NCBI Official Synonym Full Names
aminoacylase 3
NCBI Official Symbol
ACY3
NCBI Official Synonym Symbols
ACY-3; HCBP1
NCBI Protein Information
N-acyl-aromatic-L-amino acid amidohydrolase (carboxylate-forming)
UniProt Protein Name
N-acyl-aromatic-L-amino acid amidohydrolase (carboxylate-forming)
Protein Family
UniProt Gene Name
ACY3
UniProt Synonym Gene Names
ASPA2; ACY-3; HCBP1; HCV core-binding protein 1
UniProt Entry Name
ACY3_HUMAN
Uniprot Description
ACY3: Plays an important role in deacetylating mercapturic acids in kidney proximal tubules. Belongs to the AspA/AstE family. Aspartoacylase subfamily.
Protein type: Amino Acid Metabolism - histidine; Hydrolase; EC 3.5.1.114; Amino Acid Metabolism - alanine, aspartate and glutamate
Chromosomal Location of Human Ortholog: 11q13.2
Cellular Component: cytosol
Molecular Function: aminoacylase activity; protein binding
Biological Process: xenobiotic metabolic process
Research Articles on ACY3
Similar Products
Product Notes
The ACY3 acy3 (Catalog #AAA1269687) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgctcac tgcctgtgcc ccgggagccc ctgcgtcgcg tggctgtgac tgggggcacg catggcaacg agatgtcggg cgtctacctg gcccggcact ggctgcatgc ccccgcagag ctgcagagag ccagcttctc cgctgtgcct gtgctggcca acccggcagc cacatccggc tgccgccgct acgtggacca tgacctcaac cgcaccttca ccagcagctt cctcaattcc aggcccaccc cggacgaccc atatgaggtg acaagagccc gagagctgaa ccagctgctg gggcccaagg cctcgggcca ggcctttgac tttgtccttg acctgcacaa caccacggcc aacatgggca cctgcttaat cgcgaagtcc tcccacgaag tctttgccat gcacctgtgc cgccatctgc agctgcagta ccccgagctg tcctgccagg tcttcctgta ccagcggtct ggggaggaga gctacaacct ggactctgtg gccaaaaatg gactgggtct ggagctgggc ccccagccac agggtgtgct gcgggctgac attttctcaa ggatgaggac cctggtggcc acagttctgg acttcatcga actcttcaac cagggtacgg cctttcctgc ctttgagatg gaagcctata gacccgtggg cgtcgtggac ttcccccgca ccgaggccgg gcacctggca ggcactgtgc atcctcagct gcaggaccga gacttccagc cactgcagcc tggtgctccc atcttccaga tgttcagtgg ggaggacctg ctctatgagg gagagtccac ggtgtacccc gtgttcatta acgaggctgc ctactatgag aagggcgttg cctttgtcca gactgagaag ttcacattca ccgtgcctgc catgcccgcg ctgacccctg ccccgagccc agcttcctaa. It is sometimes possible for the material contained within the vial of "ACY3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
