Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACTG1 cdna clone

ACTG1 cDNA Clone

Gene Names
ACTG1; ACT; ACTG; BRWS2; DFNA20; DFNA26; HEL-176
Synonyms
ACTG1; ACTG1 cDNA Clone; ACTG1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagaagagatcgccgcgctggtcattgacaatggctccggcatgtgcaaagctggttttgctggggacgacgctccccgagccgtgtttccttccatcgtcgggcgccccagacaccagggcgtcatggtgggcatgggccagaaggactcctacgtgggcgacgaggcccagagcaagcgtggcatcctgaccctgaagtaccccattgagcatggcatcgtcaccaactgggacgacatggagaagatctggcaccacaccttctacaacgagctgcgcgtggccccggaggagcacccagtgctgctgaccgaggcccccctgaaccccaaggccaacagagagaagatgactcagattatgtttgagaccttcaacaccccggccatgtacgtggccatccaggccgtgctgtccctctacgcctctgggcgcaccactggcattgtcatggactctggagacggggtcacccacacggtgcccatctacgagggctacgccctcccccacgccatcctgcgtctggacctggctggccgggacctgaccgactacctcatgaagatcctcactgagcgaggctacagcttcaccaccacggccgagcgggaaatcgtgcgcgacatcaaggagaagctgtgctacgtcgccctggacttcgagcaggagatggccaccgccgcatcctcctcttctctggagaagagctacgagctgcccgatggccaggtcatcaccattggcaatgagcggttccggtgtccggaggcgctgttccagccttccttcctgggtatggaatcttgcggcatccacgagaccaccttcaactccatcatgaagtgtgacgtggacatccgcaaagacctgtacgccaacacggtgctgtcgggcggcaccaccatgtatccgggcattgctgacaggatgcagaaggagatcaccgccctggcgcccagcaccatgaagatcaagatcatcgcacccccagagcgcaagtactcggtgtggatcggtggctccatcctggcctcactgtccaccttccagcagatgtggattagcaagcaggagtacgacgagtcgggcccctccatcgtccaccgcaaatgcttctaa
Sequence Length
1128
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
71
Molecular Weight
41,793 Da
NCBI Official Full Name
Homo sapiens actin, gamma 1, mRNA
NCBI Official Synonym Full Names
actin gamma 1
NCBI Official Symbol
ACTG1
NCBI Official Synonym Symbols
ACT; ACTG; BRWS2; DFNA20; DFNA26; HEL-176
NCBI Protein Information
actin, cytoplasmic 2
UniProt Protein Name
Actin, cytoplasmic 2
Protein Family
UniProt Gene Name
ACTG1
UniProt Synonym Gene Names
ACTG
UniProt Entry Name
ACTG_HUMAN

NCBI Description

Actins are highly conserved proteins that are involved in various types of cell motility, and maintenance of the cytoskeleton. In vertebrates, three main groups of actin isoforms, alpha, beta and gamma have been identified. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton, and as mediators of internal cell motility. Actin, gamma 1, encoded by this gene, is a cytoplasmic actin found in non-muscle cells. Mutations in this gene are associated with DFNA20/26, a subtype of autosomal dominant non-syndromic sensorineural progressive hearing loss. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011]

Uniprot Description

ACTG1: Actins are highly conserved proteins that are involved in various types of cell motility and are ubiquitously expressed in all eukaryotic cells. Polymerization of globular actin (G-actin) leads to a structural filament (F-actin) in the form of a two-stranded helix. Each actin can bind to 4 others. Belongs to the actin family.

Protein type: Cytoskeletal; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 17q25

Cellular Component: cytoskeleton; cytosol; extracellular matrix; extracellular space; focal adhesion; membrane; nucleus; plasma membrane

Molecular Function: identical protein binding; protein binding; structural constituent of cytoskeleton; ubiquitin protein ligase binding

Biological Process: cell motility; ephrin receptor signaling pathway; retinal homeostasis; vascular endothelial growth factor receptor signaling pathway

Disease: Baraitser-winter Syndrome 2; Deafness, Autosomal Dominant 20

Research Articles on ACTG1

Similar Products

Product Notes

The ACTG1 actg1 (Catalog #AAA1265754) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagaag agatcgccgc gctggtcatt gacaatggct ccggcatgtg caaagctggt tttgctgggg acgacgctcc ccgagccgtg tttccttcca tcgtcgggcg ccccagacac cagggcgtca tggtgggcat gggccagaag gactcctacg tgggcgacga ggcccagagc aagcgtggca tcctgaccct gaagtacccc attgagcatg gcatcgtcac caactgggac gacatggaga agatctggca ccacaccttc tacaacgagc tgcgcgtggc cccggaggag cacccagtgc tgctgaccga ggcccccctg aaccccaagg ccaacagaga gaagatgact cagattatgt ttgagacctt caacaccccg gccatgtacg tggccatcca ggccgtgctg tccctctacg cctctgggcg caccactggc attgtcatgg actctggaga cggggtcacc cacacggtgc ccatctacga gggctacgcc ctcccccacg ccatcctgcg tctggacctg gctggccggg acctgaccga ctacctcatg aagatcctca ctgagcgagg ctacagcttc accaccacgg ccgagcggga aatcgtgcgc gacatcaagg agaagctgtg ctacgtcgcc ctggacttcg agcaggagat ggccaccgcc gcatcctcct cttctctgga gaagagctac gagctgcccg atggccaggt catcaccatt ggcaatgagc ggttccggtg tccggaggcg ctgttccagc cttccttcct gggtatggaa tcttgcggca tccacgagac caccttcaac tccatcatga agtgtgacgt ggacatccgc aaagacctgt acgccaacac ggtgctgtcg ggcggcacca ccatgtatcc gggcattgct gacaggatgc agaaggagat caccgccctg gcgcccagca ccatgaagat caagatcatc gcacccccag agcgcaagta ctcggtgtgg atcggtggct ccatcctggc ctcactgtcc accttccagc agatgtggat tagcaagcag gagtacgacg agtcgggccc ctccatcgtc caccgcaaat gcttctaa. It is sometimes possible for the material contained within the vial of "ACTG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.