Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACOX3 cdna clone

ACOX3 cDNA Clone

Synonyms
ACOX3; ACOX3 cDNA Clone; ACOX3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcatccactgtggaaggaggcgacacagctctgctcccagaattccccagggggcccctcgatgcctaccgagcaagagcgtccttcagctggaaggagctggcgctgttcacggaaggggagggcatgctccgctttaagaaaaccatcttctcagctcttgagaatgaccctcttttcgctcgttcccctggagccgatctgtccttggagaagtatcgcgagctgaacttccttcgatgcaagcggatcttcgagtatgacttcctcagtgtcgaagacatgttcaagagccctctgaaggtccccgccttgattcagtgcctgggcatgtatgactcttctctggctgccaagtacctcctccatagcttggtttttggatcagcagtttacagttctggttctgaaagacatctcacatatattcaaaagatcttcaggatggagatttttggatgttttgctctgaccgaattaagccacggcagtaataccaaggccattcgcacaactgcccactacgatcctgccactgaggaattcatcatacattcccctgatttcgaagctgccaagttttgggttggcaacatgggcaagacagccactcacgcggtggtgtttgctaagctgtgtgtgccaggggaccagtgccatgggctgcatccctttatcgtgcagatccgggacccgaagacccttcttcccatgcctggagtgatggttggcgacataggaaaaaaactcgggcagaacggtctggataatggtttcgccatgttccacaaggtcagagttcctcgccagagccttctgaaccggatgggagacgtcacccccgagggcacctatgtcagcccctttaaggacgtcaggcagcgctttggagcgtccctggggagcctgtcctcgggccgggtctccatcgtgagcctggccatccttaacctaaagctggccgtggccatcgctcttcgcttctcagccactcggcgtcagtttggacccacagaggaggaggaaataccagtgcttgagtatccaatgcagcaatggcgcttgcttccatatctggcagctgtctacgccttagaccatttctccaagtcgctcttcctggacctggtggagctccagcgaggacttgcatcgggagaccgcagcgccagacaggcagagcttggacgtgagatccacgccctggcatcggccagcaagcccctggcctcgtggaccacccagcaaggaattcaggaatgccgggaggcgtgtggaggacacggctatctggccatgaaccggttgggtgtccttagagatgacaacgatcccaactgcacatacgaaggtgacaacaacatcctgctgcagcagacaagcaactatttgctgggtctcctggcacaccaggtccacgatggagcttgcttccgcagtccgctgaagtcagtggactttctggacgcctatcccggcatccttgaccagaagtttgaggtctccagtgttgccgactgcttggactctgcagtcgccctggcagcatacaagtggctggtttgctacctgctccgagagacttatcaaaaattaaaccaagagaaaagatcaggaagcagtgactttgaagcaaggaacaaatgccaggtgtcccacggccgtccgttggcgctggccttcgtggagctcacggtggtccagaggttccacgagcacgtgcaccagccttccgtgccgccctcgctgcgggccgtgctggggcggctcagtgctctgtacgccctgtggtccctgagccgccacgcggccctgctctaccgagctgaaagacgatgcagttgccctggtagacgtgatcgctcctcctga
Sequence Length
1875
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,575 Da
NCBI Official Full Name
Homo sapiens acyl-Coenzyme A oxidase 3, pristanoyl, mRNA
NCBI Official Synonym Full Names
acyl-CoA oxidase 3, pristanoyl
NCBI Official Symbol
ACOX3
NCBI Protein Information
peroxisomal acyl-coenzyme A oxidase 3
UniProt Protein Name
Peroxisomal acyl-coenzyme A oxidase 3
UniProt Gene Name
ACOX3
UniProt Synonym Gene Names
BRCOX; PRCOX; BRCACox
UniProt Entry Name
ACOX3_HUMAN

NCBI Description

Acyl-Coenzyme A oxidase 3 also know as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched fatty acids in peroxisomes. Unlike the rat homolog, the human gene is expressed in very low amounts in liver such that its mRNA was undetectable by routine Northern-blot analysis or its product by immunoblotting or by enzyme activity measurements. However the human cDNA encoding a 700 amino acid protein with a peroxisomal targeting C-terminal tripeptide S-K-L was isolated and is thought to be expressed under special conditions such as specific developmental stages or in a tissue specific manner in tissues that have not yet been examined. [provided by RefSeq, Jul 2008]

Uniprot Description

ACOX3: Oxidizes the CoA-esters of 2-methyl-branched fatty acids. Belongs to the acyl-CoA oxidase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Lipid Metabolism - fatty acid; EC 1.3.3.6; Lipid Metabolism - alpha-linolenic acid; Lipid Metabolism - unsaturated fatty acid biosynthesis; Oxidoreductase

Chromosomal Location of Human Ortholog: 4p15.3

Cellular Component: membrane; peroxisomal matrix; peroxisome

Molecular Function: acyl-CoA binding; acyl-CoA dehydrogenase activity; electron carrier activity; FAD binding; pristanoyl-CoA oxidase activity; receptor binding

Biological Process: fatty acid beta-oxidation using acyl-CoA dehydrogenase; fatty acid beta-oxidation using acyl-CoA oxidase; lipid homeostasis

Research Articles on ACOX3

Similar Products

Product Notes

The ACOX3 acox3 (Catalog #AAA1267562) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcatcca ctgtggaagg aggcgacaca gctctgctcc cagaattccc cagggggccc ctcgatgcct accgagcaag agcgtccttc agctggaagg agctggcgct gttcacggaa ggggagggca tgctccgctt taagaaaacc atcttctcag ctcttgagaa tgaccctctt ttcgctcgtt cccctggagc cgatctgtcc ttggagaagt atcgcgagct gaacttcctt cgatgcaagc ggatcttcga gtatgacttc ctcagtgtcg aagacatgtt caagagccct ctgaaggtcc ccgccttgat tcagtgcctg ggcatgtatg actcttctct ggctgccaag tacctcctcc atagcttggt ttttggatca gcagtttaca gttctggttc tgaaagacat ctcacatata ttcaaaagat cttcaggatg gagatttttg gatgttttgc tctgaccgaa ttaagccacg gcagtaatac caaggccatt cgcacaactg cccactacga tcctgccact gaggaattca tcatacattc ccctgatttc gaagctgcca agttttgggt tggcaacatg ggcaagacag ccactcacgc ggtggtgttt gctaagctgt gtgtgccagg ggaccagtgc catgggctgc atccctttat cgtgcagatc cgggacccga agacccttct tcccatgcct ggagtgatgg ttggcgacat aggaaaaaaa ctcgggcaga acggtctgga taatggtttc gccatgttcc acaaggtcag agttcctcgc cagagccttc tgaaccggat gggagacgtc acccccgagg gcacctatgt cagccccttt aaggacgtca ggcagcgctt tggagcgtcc ctggggagcc tgtcctcggg ccgggtctcc atcgtgagcc tggccatcct taacctaaag ctggccgtgg ccatcgctct tcgcttctca gccactcggc gtcagtttgg acccacagag gaggaggaaa taccagtgct tgagtatcca atgcagcaat ggcgcttgct tccatatctg gcagctgtct acgccttaga ccatttctcc aagtcgctct tcctggacct ggtggagctc cagcgaggac ttgcatcggg agaccgcagc gccagacagg cagagcttgg acgtgagatc cacgccctgg catcggccag caagcccctg gcctcgtgga ccacccagca aggaattcag gaatgccggg aggcgtgtgg aggacacggc tatctggcca tgaaccggtt gggtgtcctt agagatgaca acgatcccaa ctgcacatac gaaggtgaca acaacatcct gctgcagcag acaagcaact atttgctggg tctcctggca caccaggtcc acgatggagc ttgcttccgc agtccgctga agtcagtgga ctttctggac gcctatcccg gcatccttga ccagaagttt gaggtctcca gtgttgccga ctgcttggac tctgcagtcg ccctggcagc atacaagtgg ctggtttgct acctgctccg agagacttat caaaaattaa accaagagaa aagatcagga agcagtgact ttgaagcaag gaacaaatgc caggtgtccc acggccgtcc gttggcgctg gccttcgtgg agctcacggt ggtccagagg ttccacgagc acgtgcacca gccttccgtg ccgccctcgc tgcgggccgt gctggggcgg ctcagtgctc tgtacgccct gtggtccctg agccgccacg cggccctgct ctaccgagct gaaagacgat gcagttgccc tggtagacgt gatcgctcct cctga. It is sometimes possible for the material contained within the vial of "ACOX3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.