Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACLY cdna clone

ACLY cDNA Clone

Gene Names
ACLY; ACL; ATPCL; CLATP
Synonyms
ACLY; ACLY cDNA Clone; ACLY cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggccaaggcaatttcagagcagacgggcaaagaactcctttacaagttcatctgtaccacctcagccatccagaatcggttcaagtatgctcgggtcactcctgacacagactgggcccgcttgctgcaggaccacccctggctgctcagccagaacttggtagtcaagccagaccagctgatcaaacgtcgtggaaaacttggtctcgttggggtcaacctcactctggatggggtcaagtcctggctgaagccacggctgggacaggaagccacagttggcaaggccacaggcttcctcaagaactttctgatcgagcccttcgtcccccacagtcaggctgaggagttctatgtctgcatctatgccacccgagaaggggactacgtcctgttccaccacgaggggggtgtggacgtgggtgatgtggacgccaaggcccagaagctgcttgttggcgtggatgagaaactgaatcctgaggacatcaaaaaacacctgttggtccacgcccctgaagacaagaaagaaattctggccagttttatctccggcctcttcaatttctacgaggacttgtacttcacctacctcgagatcaatccccttgtagtgaccaaagatggagtctatgtccttgacttggcggccaaggtggacgccactgccgactacatctgcaaagtgaagtggggtgacatcgagttccctccccccttcgggcgggaggcatatccagaggaagcctacattgcagacctcgatgccaaaagtggggcaagcctgaagctgaccttgctgaaccccaaagggaggatctggaccatggtggccgggggtggcgcctctgtcgtgtacagcgataccatctgtgatctagggggtgtcaacgagctggcaaactatggggagtactcaggcgcccccagcgagcagcagacctatgactatgccaagactatcctctccctcatgacccgagagaagcacccagatggcaagatcctcatcattggaggcagcatcgcaaacttcaccaacgtggctgccacgttcaagggcatcgtgagagcaattcgagattaccagggccccctgaaggagcacgaagtcacaatctttgtccgaagaggtggccccaactatcaggagggcttacgggtgatgggagaagtcgggaagaccactgggatccccatccatgtctttggcacagagactcacatgacggccattgtgggcatggccctgggccaccggcccatccccaaccagccacccacagcggcccacactgcaaacttcctcctcaacgccagcgggagcacatcgacgccagcccccagcaggacagcatctttttctgagtccagggccgatgaggtggcgcctgcaaagaaggccaagcctgccatgccacaagattcagtcccaagtccaagatccctgcaaggaaagagcaccaccctcttcagccgccacaccaaggccattgtgtggggcatgcagacccgggccgtgcaaggcatgctggactttgactatgtctgctcccgagacgagccctcagtggctgccatggtctaccctttcactggggaccacaagcagaagttttactgggggcacaaagagatcctgatccctgtcttcaagaacatggctgatgccatgaggaagcatccggaggtagatgtgctcatcaactttgcctctctccgctctgcctatgacagcaccatggagaccatgaactatgcccagatccggaccatcgccatcatagctgaaggcatccctgaggccctcacgagaaagctgatcaagaaggcggaccagaagggagtgaccatcatcggacctgccactgttggaggcatcaagcctgggtgctttaagattggcaacacaggtgggatgctggacaacatcctggcctccaaactgtaccgcccaggcagcgtggcctatgtctcacgttccggaggcatgtccaacgagctcaacaatatcatctctcggaccacggatggcgtctatgagggcgtggccattggtggggacaggtacccgggctccacattcatggatcatgtgttacgctatcaggacactccaggagtcaaaatgattgtggttcttggagagattgggggcactgaggaatataagatttgccggggcatcaaggagggccgcctcactaagcccatcgtctgctggtgcatcgggacgtgtgccaccatgttctcctctgaggtccagtttggccatgctggagcttgtgccaaccaggcttctgaaactgcagtagccaagaaccaggctttgaaggaagcaggagtgtttgtgccccggagctttgatgagcttggagagatcatccagtctgtatacgaagatctcgtggccaatggagtcattgtacctgcccaggaggtgccgcccccaaccgtgcccatggactactcctgggccagggagcttggtttgatccgcaaacctgcctcgttcatgaccagcatctgcgatgagcgaggacaggagctcatctacgcgggcatgcccatcactgaggtcttcaaggaagagatgggcattggcggggtcctcggcctcctctggttccagaaaaggttgcctaagtactcttgccagttcattgagatgtgtctgatggtgacagctgatcacgggccagccgtctctggagcccacaacaccatcatttgtgcgcgagctgggaaagacctggtctccagcctcacctcggggctgctcaccatcggggatcggtttgggggtgccttggatgcagcagccaagatgttcagtaaagcctttgacagtggcattatccccatggagtttgtgaacaagatgaagaaggaagggaagctgatcatgggcattggtcaccgagtgaagtcgataaacaacccagacatgcgagtgcagatcctcaaagattacgtcaggcagcacttccctgccactcctctgctcgattatgcactggaagtagagaagattaccacctcgaagaagccaaatcttatcctgaatgtagatggtctcatcggagtcgcatttgtagacatgcttagaaactgtgggtcctttactcgggaggaagctgatgaatatattgacattggagccctcaatggcatctttgtgctgggaaggagtatggggttcattggacactatcttgatcagaagaggctgaagcaggggctgtatcgtcatccgtgggatgatatttcatatgttcttccggaacacatgagcatgtaa
Sequence Length
3306
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
47
Molecular Weight
91,099 Da
NCBI Official Full Name
Homo sapiens ATP citrate lyase, mRNA
NCBI Official Synonym Full Names
ATP citrate lyase
NCBI Official Symbol
ACLY
NCBI Official Synonym Symbols
ACL; ATPCL; CLATP
NCBI Protein Information
ATP-citrate synthase
UniProt Protein Name
ATP-citrate synthase
Protein Family
UniProt Gene Name
ACLY
UniProt Synonym Gene Names
ACL
UniProt Entry Name
ACLY_HUMAN

NCBI Description

ATP citrate lyase is the primary enzyme responsible for the synthesis of cytosolic acetyl-CoA in many tissues. The enzyme is a tetramer (relative molecular weight approximately 440,000) of apparently identical subunits. It catalyzes the formation of acetyl-CoA and oxaloacetate from citrate and CoA with a concomitant hydrolysis of ATP to ADP and phosphate. The product, acetyl-CoA, serves several important biosynthetic pathways, including lipogenesis and cholesterogenesis. In nervous tissue, ATP citrate-lyase may be involved in the biosynthesis of acetylcholine. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Dec 2014]

Uniprot Description

ACLY: ATP citrate-lyase is the primary enzyme responsible for the synthesis of cytosolic acetyl-CoA in many tissues. Has a central role in de novo lipid synthesis. In nervous tissue it may be involved in the biosynthesis of acetylcholine. Homotetramer. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Carbohydrate Metabolism - citrate (TCA) cycle; EC 2.3.3.8; Lyase; Transferase

Chromosomal Location of Human Ortholog: 17q21.2

Cellular Component: cytoplasm; cytosol; membrane; nucleoplasm; plasma membrane

Molecular Function: ATP binding; ATP citrate synthase activity; protein binding

Biological Process: acetyl-CoA biosynthetic process; cholesterol biosynthetic process; citrate metabolic process; lipid biosynthetic process; oxaloacetate metabolic process; positive regulation of cellular metabolic process

Research Articles on ACLY

Similar Products

Product Notes

The ACLY acly (Catalog #AAA1268164) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggcca aggcaatttc agagcagacg ggcaaagaac tcctttacaa gttcatctgt accacctcag ccatccagaa tcggttcaag tatgctcggg tcactcctga cacagactgg gcccgcttgc tgcaggacca cccctggctg ctcagccaga acttggtagt caagccagac cagctgatca aacgtcgtgg aaaacttggt ctcgttgggg tcaacctcac tctggatggg gtcaagtcct ggctgaagcc acggctggga caggaagcca cagttggcaa ggccacaggc ttcctcaaga actttctgat cgagcccttc gtcccccaca gtcaggctga ggagttctat gtctgcatct atgccacccg agaaggggac tacgtcctgt tccaccacga ggggggtgtg gacgtgggtg atgtggacgc caaggcccag aagctgcttg ttggcgtgga tgagaaactg aatcctgagg acatcaaaaa acacctgttg gtccacgccc ctgaagacaa gaaagaaatt ctggccagtt ttatctccgg cctcttcaat ttctacgagg acttgtactt cacctacctc gagatcaatc cccttgtagt gaccaaagat ggagtctatg tccttgactt ggcggccaag gtggacgcca ctgccgacta catctgcaaa gtgaagtggg gtgacatcga gttccctccc cccttcgggc gggaggcata tccagaggaa gcctacattg cagacctcga tgccaaaagt ggggcaagcc tgaagctgac cttgctgaac cccaaaggga ggatctggac catggtggcc gggggtggcg cctctgtcgt gtacagcgat accatctgtg atctaggggg tgtcaacgag ctggcaaact atggggagta ctcaggcgcc cccagcgagc agcagaccta tgactatgcc aagactatcc tctccctcat gacccgagag aagcacccag atggcaagat cctcatcatt ggaggcagca tcgcaaactt caccaacgtg gctgccacgt tcaagggcat cgtgagagca attcgagatt accagggccc cctgaaggag cacgaagtca caatctttgt ccgaagaggt ggccccaact atcaggaggg cttacgggtg atgggagaag tcgggaagac cactgggatc cccatccatg tctttggcac agagactcac atgacggcca ttgtgggcat ggccctgggc caccggccca tccccaacca gccacccaca gcggcccaca ctgcaaactt cctcctcaac gccagcggga gcacatcgac gccagccccc agcaggacag catctttttc tgagtccagg gccgatgagg tggcgcctgc aaagaaggcc aagcctgcca tgccacaaga ttcagtccca agtccaagat ccctgcaagg aaagagcacc accctcttca gccgccacac caaggccatt gtgtggggca tgcagacccg ggccgtgcaa ggcatgctgg actttgacta tgtctgctcc cgagacgagc cctcagtggc tgccatggtc taccctttca ctggggacca caagcagaag ttttactggg ggcacaaaga gatcctgatc cctgtcttca agaacatggc tgatgccatg aggaagcatc cggaggtaga tgtgctcatc aactttgcct ctctccgctc tgcctatgac agcaccatgg agaccatgaa ctatgcccag atccggacca tcgccatcat agctgaaggc atccctgagg ccctcacgag aaagctgatc aagaaggcgg accagaaggg agtgaccatc atcggacctg ccactgttgg aggcatcaag cctgggtgct ttaagattgg caacacaggt gggatgctgg acaacatcct ggcctccaaa ctgtaccgcc caggcagcgt ggcctatgtc tcacgttccg gaggcatgtc caacgagctc aacaatatca tctctcggac cacggatggc gtctatgagg gcgtggccat tggtggggac aggtacccgg gctccacatt catggatcat gtgttacgct atcaggacac tccaggagtc aaaatgattg tggttcttgg agagattggg ggcactgagg aatataagat ttgccggggc atcaaggagg gccgcctcac taagcccatc gtctgctggt gcatcgggac gtgtgccacc atgttctcct ctgaggtcca gtttggccat gctggagctt gtgccaacca ggcttctgaa actgcagtag ccaagaacca ggctttgaag gaagcaggag tgtttgtgcc ccggagcttt gatgagcttg gagagatcat ccagtctgta tacgaagatc tcgtggccaa tggagtcatt gtacctgccc aggaggtgcc gcccccaacc gtgcccatgg actactcctg ggccagggag cttggtttga tccgcaaacc tgcctcgttc atgaccagca tctgcgatga gcgaggacag gagctcatct acgcgggcat gcccatcact gaggtcttca aggaagagat gggcattggc ggggtcctcg gcctcctctg gttccagaaa aggttgccta agtactcttg ccagttcatt gagatgtgtc tgatggtgac agctgatcac gggccagccg tctctggagc ccacaacacc atcatttgtg cgcgagctgg gaaagacctg gtctccagcc tcacctcggg gctgctcacc atcggggatc ggtttggggg tgccttggat gcagcagcca agatgttcag taaagccttt gacagtggca ttatccccat ggagtttgtg aacaagatga agaaggaagg gaagctgatc atgggcattg gtcaccgagt gaagtcgata aacaacccag acatgcgagt gcagatcctc aaagattacg tcaggcagca cttccctgcc actcctctgc tcgattatgc actggaagta gagaagatta ccacctcgaa gaagccaaat cttatcctga atgtagatgg tctcatcgga gtcgcatttg tagacatgct tagaaactgt gggtccttta ctcgggagga agctgatgaa tatattgaca ttggagccct caatggcatc tttgtgctgg gaaggagtat ggggttcatt ggacactatc ttgatcagaa gaggctgaag caggggctgt atcgtcatcc gtgggatgat atttcatatg ttcttccgga acacatgagc atgtaa. It is sometimes possible for the material contained within the vial of "ACLY, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.