Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ABCC4 cdna clone

ABCC4 cDNA Clone

Gene Names
ABCC4; MRP4; MOATB; MOAT-B
Synonyms
ABCC4; ABCC4 cDNA Clone; ABCC4 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcccgtgtaccaggaggtgaagcccaacccgctgcaggacgcgaacctctgctcacgcgtgttcttctggtggctcaatcccttgtttaaaattggccataaacggagattagaggaagatgatatgtattcagtgctgccagaagaccgctcacagcaccttggagaggagttgcaagggttctgggataaagaagttttaagagctgagaatgacgcacagaagccttctttaacaagagcaatcataaagtgttactggaaatcttatttagttttgggaatttttacgttaattgaggaaagtgccaaagtaatccagcccatatttttgggaaaaattattaattattttgaaaattatgatcccatggattctgtggctttgaacacagcgtacgcctatgccacggtgctgactttttgcacgctcattttggctatactgcatcacttatatttttatcacgttcagtgtgctgggatgaggttacgagtagccatgtgccatatgatttatcggaaggcacttcgtcttagtaacatggccatggggaagacaaccacaggccagatagtcaatctgctgtccaatgatgtgaacaagtttgatcaggtgacagtgttcttacacttcctgtgggcaggaccactgcaggcgatcgcagtgactgccctactctggatggagataggaatatcgtgccttgctgggatggcagttctaatcattctcctgcccttgcaaagctgttttgggaagttgttctcatcactgaggagtaaaactgcaactttcacggatgccaggatcaggaccatgaatgaagttataactggtataaggataataaaaatgtacgcctgggaaaagtcattttcaaatcttattaccaatttgagaaagaaggagatttccaagattctgagaagttcctgcctcagggggatgaatttggcttcgtttttcagtgcaagcaaaatcatcgtgtttgtgaccttcaccacctacgtgctcctcggcagtgtgatcacagccagccgcgtgttcgtggcagtgacgctgtatggggctgtgcggctgacggttaccctcttcttcccctcagccattgagagggtgtcagaggcaatcgtcagcatccgaagaatccagacctttttgctacttgatgagatatcacagcgcaaccgtcagctgccgtcagatggtaaaaagatggtgcatgtgcaggattttactgctttttgggataaggcatcagagaccccaactctacaaggcctttcctttactgtcagacctggcgaattgttagctgtggtcggccccgtgggagcagggaagtcatcactgttaagtgccgtgctcggggaattggccccaagtcacgggctggtcagcgtgcatggaagaattgcctatgtgtctcagcagccctgggtgttctcgggaactctgaggagtaatattttatttgggaagaaatacgaaaaggaacgatatgaaaaagtcataaaggcttgtgctctgaaaaaggatttacagctgttggaggatggtgatctgactgtgataggagatcggggaaccacgctgagtggagggcagaaagcacgggtaaaccttgcaagagcagtgtatcaagatgctgacatctatctcctggacgatcctctcagtgcagtagatgcggaagttagcagacacttgttcgaactgtgtatttgtcaaattttgcatgagaagatcacaattttagtgactcatcagttgcagtacctcaaagctgcaagtcagattctgatattgaaagatggtaaaatggtgcagaaggggacttacactgagttcctaaaatctggtatagattttggctcccttttaaagaaggataatgaggaaagtgaacaacctccagttccaggaactcccacactaaggaatcgtaccttctcagagtcttcggtttggtctcaacaatcttctagaccctccttgaaagatggtgctctggagagccaagatacagagaatgtcccagttacactatcagaggagaaccgttctgaaggaaaagttggttttcaggcctataagaattacttcagagctggtgctcactggattgtcttcattttccttattctcctaaacactgcagctcaggttgcctatgtgcttcaagattggtggctttcatactgggcaaacaaacaaagtatgctaaatgtcactgtaaatggaggaggaaatgtaaccgagaagctagatcttaactggtacttaggaatttattcaggtttaactgtagctaccgttctttttggcatagcaagatctctattggtattctacgtccttgttaactcttcacaaactttgcacaacaaaatgtttgagtcaattctgaaagctccggtattattctttgatagaaatccaataggaagaattttaaatcgtttctccaaagacattggacacttggatgatttgctgccgctgacgtttttagatttcatccagagatgggatctcgctgtgttgtcctggctggtctcaaactcctag
Sequence Length
2580
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
88,138 Da
NCBI Official Full Name
Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 4, mRNA
NCBI Official Synonym Full Names
ATP binding cassette subfamily C member 4
NCBI Official Symbol
ABCC4
NCBI Official Synonym Symbols
MRP4; MOATB; MOAT-B
NCBI Protein Information
multidrug resistance-associated protein 4
UniProt Protein Name
Multidrug resistance-associated protein 4
Protein Family
UniProt Gene Name
ABCC4
UniProt Synonym Gene Names
MRP4; MOAT-B
UniProt Entry Name
MRP4_HUMAN

NCBI Description

The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This family member plays a role in cellular detoxification as a pump for its substrate, organic anions. It may also function in prostaglandin-mediated cAMP signaling in ciliogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]

Uniprot Description

ABCC4: a widely-expressed multi-pass membrane protein. An organic anion pump involved in cellular detoxification. Widely expressed, with particularly high levels in prostate, but is barely detectable in liver.

Protein type: Transporter; Membrane protein, multi-pass; Membrane protein, integral; Transporter, ABC family

Chromosomal Location of Human Ortholog: 13q32

Cellular Component: basolateral plasma membrane; membrane; plasma membrane; platelet dense granule membrane

Molecular Function: anion transmembrane-transporting ATPase activity; ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism

Biological Process: cilium biogenesis; platelet degranulation; prostaglandin secretion; transmembrane transport

Research Articles on ABCC4

Similar Products

Product Notes

The ABCC4 abcc4 (Catalog #AAA1270623) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcccg tgtaccagga ggtgaagccc aacccgctgc aggacgcgaa cctctgctca cgcgtgttct tctggtggct caatcccttg tttaaaattg gccataaacg gagattagag gaagatgata tgtattcagt gctgccagaa gaccgctcac agcaccttgg agaggagttg caagggttct gggataaaga agttttaaga gctgagaatg acgcacagaa gccttcttta acaagagcaa tcataaagtg ttactggaaa tcttatttag ttttgggaat ttttacgtta attgaggaaa gtgccaaagt aatccagccc atatttttgg gaaaaattat taattatttt gaaaattatg atcccatgga ttctgtggct ttgaacacag cgtacgccta tgccacggtg ctgacttttt gcacgctcat tttggctata ctgcatcact tatattttta tcacgttcag tgtgctggga tgaggttacg agtagccatg tgccatatga tttatcggaa ggcacttcgt cttagtaaca tggccatggg gaagacaacc acaggccaga tagtcaatct gctgtccaat gatgtgaaca agtttgatca ggtgacagtg ttcttacact tcctgtgggc aggaccactg caggcgatcg cagtgactgc cctactctgg atggagatag gaatatcgtg ccttgctggg atggcagttc taatcattct cctgcccttg caaagctgtt ttgggaagtt gttctcatca ctgaggagta aaactgcaac tttcacggat gccaggatca ggaccatgaa tgaagttata actggtataa ggataataaa aatgtacgcc tgggaaaagt cattttcaaa tcttattacc aatttgagaa agaaggagat ttccaagatt ctgagaagtt cctgcctcag ggggatgaat ttggcttcgt ttttcagtgc aagcaaaatc atcgtgtttg tgaccttcac cacctacgtg ctcctcggca gtgtgatcac agccagccgc gtgttcgtgg cagtgacgct gtatggggct gtgcggctga cggttaccct cttcttcccc tcagccattg agagggtgtc agaggcaatc gtcagcatcc gaagaatcca gacctttttg ctacttgatg agatatcaca gcgcaaccgt cagctgccgt cagatggtaa aaagatggtg catgtgcagg attttactgc tttttgggat aaggcatcag agaccccaac tctacaaggc ctttccttta ctgtcagacc tggcgaattg ttagctgtgg tcggccccgt gggagcaggg aagtcatcac tgttaagtgc cgtgctcggg gaattggccc caagtcacgg gctggtcagc gtgcatggaa gaattgccta tgtgtctcag cagccctggg tgttctcggg aactctgagg agtaatattt tatttgggaa gaaatacgaa aaggaacgat atgaaaaagt cataaaggct tgtgctctga aaaaggattt acagctgttg gaggatggtg atctgactgt gataggagat cggggaacca cgctgagtgg agggcagaaa gcacgggtaa accttgcaag agcagtgtat caagatgctg acatctatct cctggacgat cctctcagtg cagtagatgc ggaagttagc agacacttgt tcgaactgtg tatttgtcaa attttgcatg agaagatcac aattttagtg actcatcagt tgcagtacct caaagctgca agtcagattc tgatattgaa agatggtaaa atggtgcaga aggggactta cactgagttc ctaaaatctg gtatagattt tggctccctt ttaaagaagg ataatgagga aagtgaacaa cctccagttc caggaactcc cacactaagg aatcgtacct tctcagagtc ttcggtttgg tctcaacaat cttctagacc ctccttgaaa gatggtgctc tggagagcca agatacagag aatgtcccag ttacactatc agaggagaac cgttctgaag gaaaagttgg ttttcaggcc tataagaatt acttcagagc tggtgctcac tggattgtct tcattttcct tattctccta aacactgcag ctcaggttgc ctatgtgctt caagattggt ggctttcata ctgggcaaac aaacaaagta tgctaaatgt cactgtaaat ggaggaggaa atgtaaccga gaagctagat cttaactggt acttaggaat ttattcaggt ttaactgtag ctaccgttct ttttggcata gcaagatctc tattggtatt ctacgtcctt gttaactctt cacaaacttt gcacaacaaa atgtttgagt caattctgaa agctccggta ttattctttg atagaaatcc aataggaaga attttaaatc gtttctccaa agacattgga cacttggatg atttgctgcc gctgacgttt ttagatttca tccagagatg ggatctcgct gtgttgtcct ggctggtctc aaactcctag. It is sometimes possible for the material contained within the vial of "ABCC4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.