Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LAGE3 cdna clone

LAGE3

Gene Names
LAGE3; CVG5; ESO3; Pcc1; ITBA2; GAMOS2; DXS9879E; DXS9951E
Synonyms
LAGE3; CVG5; DXS9879E; DXS9951E; ESO3; ITBA2; LAGE3 cdna clone
Ordering
For Research Use Only!
Form/Format
Lyophilized
Sequence
Nucleotide Sequence: ATGCGGGACGCGGATGCAGACGCAGGCGGAGGCGCTGACGGCGGGGATGGCCGGGGTGGCCACAGCTGCCGCGGGGGCGTGGACACAGCCGCAGCTCCGGCCGGTGGAGCTCCCCCAGCGCACGCGCCAGGTCCGGGCAGAGACGCCGCGTCTGCGGCCAGGGGGTCACGAATGCGGCCGCACATATTCACCCTCAGCGTGCCTTTCCCGACCCCCTTGGAGGCGGAAATCGCCCATGGGTCCCTGGCACCAGATGCCGAGCCCCACCAAAGGGTGGTTGGGAAGGATCTCACAGTGAGTGGCAGGATCCTGGTCGTCCGCTGGAAAGCTGAAGACTGTCGCCTGCTCCGAATTTCCGTCATCAACTTTCTTGACCAGCTTTCCCTGGTGGTGCGGACCATGCAGCGCTTTGGGCCCCCCGTTTCCCGCTAA

Translation Sequence: MRDADADAGG GADGGDGRGG HSCRGGVDTA AAPAGGAPPA HAPGPGRDAA SAARGSRMRPHIFTLSVPFP TPLEAEIAHG SLAPDAEPHQ RVVGKDLTVS GRILVVRWKA EDCRLLRISVINFLDQLSLV VRTMQRFGPP VSR
Sequence Length
143
Species
Human
Chromosome Location
Xq28
OMIM Reference Number
300060
cDNA Size
432bp
Vector Description
This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Vector
(puc19-derived cloning vector)
Preparation Before Usage
1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
Preparation and Storage
Store the plasmid at -20 degree C.
Related Product Information for LAGE3 cdna clone
LAGE3 belongs to the ESO/LAGE gene family, members of which are clustered together on chromosome Xq28, and have similar exon-intron structures.
Product Categories/Family for LAGE3 cdna clone

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
NCBI Accession #
NCBI GenBank Nucleotide #
UniProt Accession #
NCBI Official Full Name
EKC/KEOPS complex subunit LAGE3
NCBI Official Synonym Full Names
L antigen family member 3
NCBI Official Symbol
LAGE3
NCBI Official Synonym Symbols
CVG5; ESO3; Pcc1; ITBA2; GAMOS2; DXS9879E; DXS9951E
NCBI Protein Information
EKC/KEOPS complex subunit LAGE3
UniProt Protein Name
EKC/KEOPS complex subunit LAGE3
Protein Family
UniProt Gene Name
LAGE3
UniProt Synonym Gene Names
DXS9879E; ESO3; ITBA2
UniProt Entry Name
LAGE3_HUMAN

NCBI Description

This gene belongs to the ESO/LAGE gene family, members of which are clustered together on chromosome Xq28, and have similar exon-intron structures. Unlike the other family members which are normally expressed only in testis and activated in a wide range of human tumors, this gene is ubiquitously expressed in somatic tissues. The latter, combined with the finding that it is highly conserved in mouse and rat, suggests that the encoded protein is functionally important. An intronless pseudogene with high sequence similarity to this gene is located on chromosome 9. [provided by RefSeq, Jul 2008]

Uniprot Description

LAGE3: a member of the ESO/LAGE gene family, members of which are clustered together on chromosome Xq28, and have similar exon-intron structures. Unlike the other family members which are normally expressed only in testis and activated in a wide range of human tumors, this gene is ubiquitously expressed in somatic tissues. The latter, combined with the finding that it is highly conserved in mouse and rat, suggests that the encoded protein is functionally important. An intronless pseudogene with high sequence similarity to this gene is located on chromosome 9. [provided by RefSeq, Jul 2008]

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: nucleus

Biological Process: tRNA processing

Similar Products

Product Notes

The LAGE3 lage3 (Catalog #AAA200899) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: Nucleotide Sequence: ATGCGGGACG CGGATGCAGA CGCAGGCGGA GGCGCTGACG GCGGGGATGG CCGGGGTGGC CACAGCTGCC GCGGGGGCGT GGACACAGCC GCAGCTCCGG CCGGTGGAGC TCCCCCAGCG CACGCGCCAG GTCCGGGCAG AGACGCCGCG TCTGCGGCCA GGGGGTCACG AATGCGGCCG CACATATTCA CCCTCAGCGT GCCTTTCCCG ACCCCCTTGG AGGCGGAAAT CGCCCATGGG TCCCTGGCAC CAGATGCCGA GCCCCACCAA AGGGTGGTTG GGAAGGATCT CACAGTGAGT GGCAGGATCC TGGTCGTCCG CTGGAAAGCT GAAGACTGTC GCCTGCTCCG AATTTCCGTC ATCAACTTTC TTGACCAGCT TTCCCTGGTG GTGCGGACCA TGCAGCGCTT TGGGCCCCCC GTTTCCCGCT AA Translatio n Sequence: MRDADADAGG GADGGDGRGG HSCRGGVDTA AAPAGGAPPA HAPGPGRDAA SAARGSRMRP HIFTLSVPFP TPLEAEIAHG SLAPDAEPHQ RVVGKDLTVS GRILVVRWKA EDCRLLRISV INFLDQLSLV VRTMQRFGPP VSR. It is sometimes possible for the material contained within the vial of "LAGE3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.