CPSF4 cdna clone

CPSF4

Cat. Num. AAA200774

• Gene Names: CPSF4; NAR; NEB1; NEB-1; CPSF30
• Synonyms: CPSF4; CPSF30; NAR; NEB1; CPSF4 cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGCAGGAAATCATCGCCAGCGTGGACCACATCAAGTTTGACTTGGAGATCGCGGTGGAGCAGCAGCTGGGGGCGCAGCCGCTGCCCTTCCCCGGCATGGACAAGTCGGGCGCTGCTGTCTGTGAATTCTTTTTGAAAGCTGCCTGCGGCAAAGGGGGCATGTGTCCGTTTCGCCACATCAGTGGTGAGAAGACAGTTGTGTGCAAACACTGGCTGCGTGGCCTATGCAAGAAAGGGGACCAGTGTGAGTTCCTGCATGAGTATGACATGACCAAGATGCCCGAGTGCTACTTCTACTCCAAGTTCGGGGAGTGCAGCAACAAGGAATGTCCCTTCCTGCACATCGACCCCGAGTCCAAGATCAAGGACTGTCCTTGGTATGACCGTGGCTTCTGCAAGCACGGTCCCCTCTGCAGGCACCGGCACACACGGAGAGTCATCTGTGTGAATTACCTCGTGGGATTCTGCCCGGAGGGGCCCTCGTGTAAATTCATGCACCCTCGATTTGAACTGCCCATGGGAACCACCGAGCAGCCCCCACTGCCGCAGCAGACACAGCCTCCAGCAAAGCAGAGAACCCCGCAGGTCATCGGGGTCATGCAGAGTCAAAACAGCAGCGCGGGCAACCGGGGACCCCGGCCACTGGAGCAGGTCACCTGTTACAAGTGTGGCGAGAAAGGACACTACGCCAACAGATGCACCAAAGGGCACTTGGCCTTTCTCAGTGGACAGTGA; ; Translation Sequence: MQEIIASVDH IKFDLEIAVE QQLGAQPLPF PGMDKSGAAV CEFFLKAACG KGGMCPFRHISGEKTVVCKH WLRGLCKKGD QCEFLHEYDM TKMPECYFYS KFGECSNKEC PFLHIDPESKIKDCPWYDRG FCKHGPLCRH RHTRRVICVN YLVGFCPEGP SCKFMHPRFE LPMGTTEQPPLPQQTQPPAK QRTPQVIGVM QSQNSSAGNR GPRPLEQVTC YKCGEKGHYA NRCTKGHLAFLSGQ
• Sequence Length: 244

• Species: Human
• Chromosome Location: 7q22.1
• OMIM Reference Number: 603052
• cDNA Size: 735bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for CPSF4 cdna clone

Inhibition of the nuclear export of poly (A) -containing mRNAs caused by the influenza A virus NS1 protein requires its effector domain. The NS1 effector domain functionally interacts with the cellular 30 kDa subunit of cleavage and polyadenylation specific factor 4, an essential component of the 3' end processing machinery of cellular pre-mRNAs. In influenza virus-infected cells, the NS1 protein is physically associated with cleavage and polyadenylation specific factor 4, 30kD subunit. Binding of the NS1 protein to the 30 kDa protein in vitro prevents CPSF binding to the RNA substrate and inhibits 3' end cleavage and polyadenylation of host pre-mRNAs. Thus the NS1 protein selectively inhibits the nuclear export of cellular, and not viral, mRNAs. Multiple alternatively spliced transcript variants that encode different isoforms have been described for CPSF4.

Product Categories/Family for CPSF4 cdna clone

Epigenomics (Transcription & Translation)

NCBI and Uniprot Product Information

• NCBI GI #: 125987603
• NCBI GeneID: 10898
• NCBI Accession #: NP_001075028.1
• NCBI GenBank Nucleotide #: NM_001081559.1
• UniProt Accession #: O95639
• NCBI Official Full Name: cleavage and polyadenylation specificity factor subunit 4 isoform 2
• NCBI Official Synonym Full Names: cleavage and polyadenylation specific factor 4
• NCBI Official Symbol: CPSF4
• NCBI Official Synonym Symbols: NAR; NEB1; NEB-1; CPSF30
• NCBI Protein Information: cleavage and polyadenylation specificity factor subunit 4
• UniProt Protein Name: Cleavage and polyadenylation specificity factor subunit 4
• Protein Family: Cleavage and polyadenylation specificity factor
• UniProt Gene Name: CPSF4
• UniProt Synonym Gene Names: CPSF30; NAR; NEB1; CPSF 30 kDa subunit; Neb-1
• UniProt Entry Name: CPSF4_HUMAN

NCBI Description

Inhibition of the nuclear export of poly(A)-containing mRNAs caused by the influenza A virus NS1 protein requires its effector domain. The NS1 effector domain functionally interacts with the cellular 30 kDa subunit of cleavage and polyadenylation specific factor 4, an essential component of the 3' end processing machinery of cellular pre-mRNAs. In influenza virus-infected cells, the NS1 protein is physically associated with cleavage and polyadenylation specific factor 4, 30kD subunit. Binding of the NS1 protein to the 30 kDa protein in vitro prevents CPSF binding to the RNA substrate and inhibits 3' end cleavage and polyadenylation of host pre-mRNAs. Thus the NS1 protein selectively inhibits the nuclear export of cellular, and not viral, mRNAs. Multiple alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

CPSF4: Component of the cleavage and polyadenylation specificity factor (CPSF) complex that play a key role in pre-mRNA 3'-end formation, recognizing the AAUAAA signal sequence and interacting with poly(A) polymerase and other factors to bring about cleavage and poly(A) addition. CPSF4 binds RNA polymers with a preference for poly(U). Belongs to the CPSF4/YTH1 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA processing; Mitochondrial

Chromosomal Location of Human Ortholog: 7q22.1

Cellular Component: nucleoplasm; mRNA cleavage and polyadenylation specificity factor complex

Molecular Function: zinc ion binding

Biological Process: modification by virus of host cellular process; virus-host interaction; modification by virus of host mRNA processing; viral infectious cycle; mRNA processing